clinical effects of a robotic gait training

... hemorrhagic left basal ganglia A2 68 M 1064 34 hemorrhagic right basal ganglia A3 48 M 323 13 hemorrhagic left basal ganglia A4 46 M 679 34 ischemic right temporal, basal ganglia, corona radiata, ... basal ganglia A9 43 F 417 37 hemorrhagic* right frontal lobe A1 0 71 F 318 40 ischemic A1 1 65 F 271 33 ischemic* right corona radiata, basal ganglia right basal ganglia, corona radiata, external ... external capsule frontal-parietal, thalamus A1 2 31 M 297 35 hemorrhagic right parietal lobe A1 3 55 M 480 14 hemorrhagic right basal ganglia A1 4 44 F 627 41 hemorrhagic left basal ganglia A1 5 32...

Ngày tải lên: 19/06/2014, 08:20

... safely and with minimum disruption of their unloaded gait pattern List of abbreviations ANOVA: analysis of variance; AROM: active range of motion; BMI: body mass index; MMSE: mini mental state ... (90°) subtracted bNonparetic range of motion for participants and are marked with dashes to indicate missing data because it was not measured in these two individuals Khanna et al Journal of NeuroEngineering ... distal attachment via quick-release mechanisms as well as a single strap over the proximal metatarsals The robot connects to the knee brace proximally via a set of quick-release locking clamps An...

Ngày tải lên: 19/06/2014, 08:20

... ages 20–40), mean and SE Age Group Baseline aMT6s Acrophase Final aMT6s Acrophase Baseline Circadian Malsynch Final Circadian Malsynch Baseline Circadian Dispersion Final Circadian Dispersion ... Journal of Circadian Rhythms 2005, 3:11 Figure Circadian malsynchronization at baseline and final assessment Circadian malsynchronization at baseline and final assessment Shown is circadian malsynchronization, ... differed, on average, by 0.03 hours Baseline aMT6s acrophase was compared across treatment and age group via × ANOVA Final aMT6 acrophase was determined from urinary data collected during the final 24–30...

Ngày tải lên: 10/08/2014, 09:20

... composition of plasma PC was measured as an indicator of n-6 and n-3 fatty acid status Plasma PC contributes about 75% of plasma phospholipid [33] and functions as a transport pool of fatty acids delivering ... Data are mean ± SEM CRP = C-reactive protein; AST = Aspartate transaminase; ALT = Alanine transaminase; GGT = γ-glutamyl transpeptidase *P = 0.024 vs MCT/LCT at the same timepoint Barbosa et al ... resolution of inflammation as a mechanism of action of n-3 fatty acids and on the differential effects of EPA and DHA on inflammatory processes In the current study status of EPA, but not DHA, was increased...

Ngày tải lên: 13/08/2014, 20:21

... 1317813188 Maithal K, Ravindra G, Balaram H & Balaram P (2002) Inhibition of Plasmodium falciparum triosephosphate isomerase by chemical modication of an interface cysteine: electrospray ionization mass ... GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors Journal compilation ê 2009 FEBS M Banerjee et al ... 441456 Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme Pure Appl Chem 77, 281289 Parthasarathy S, Ravindra G, Balaram H, Balaram P & Murthy...

Ngày tải lên: 18/02/2014, 11:20

... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... PRMT reaction, the use of SAM analogs is a logical strategy for the direct inhibition of PRMTs As a SAM analog, sinefungin can compete for SAM binding and inhibit the activity of all SAM-dependent ... Bonham et al 11 Clarke SG (2006) Inhibition of mammalian protein methyltransferases by 5¢-methylthioadenosine (MTA): a mechanism of action of dietary SAMe? In The Enzymes: Protein Methyltransferases...

Ngày tải lên: 06/03/2014, 11:20

... tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal model of septic ... IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ± SD The significance of the results was assessed ... protein sequence Angle, the calculated angle between the helix axis and the plane of a model membrane ASA, accessible surface area +, the peptide has an adequate mean surface accessibility ‡ 30%...

Ngày tải lên: 07/03/2014, 01:20

... same Ala substitution was reported to cause a significant decrease in biological activities of [Ala8]NKA measured in human tissues [44] Indeed, [Ala8]NKA(4–10) was shown to be a weak partial agonist ... solvent variation, causing an underestimation of calculated CSDs These CSDHa and CSDCa variations demonstrate the formation of more stable and abundant helical structures for [Aib9]SP than for ... 180°, cannot overlap any conformation of a- amino acids In order to visualize on the potential energy surfaces the conformers of b-amino acids that fit with canonical conformations of a- amino acids,...

Ngày tải lên: 08/03/2014, 08:20

... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... physiological consequence Again, the ADAM10 transgenes remained without effect in all investigated mouse lines (Fig 5A) G-ratios of ADAM10mo as well as of ADAM10dn mice at postnatal day 17 were identical...

Ngày tải lên: 16/03/2014, 04:20

... Geometra Cartesiana 2nd edn McGraw-Hill Interamericana de Espana, Madrid 62 de Burgos-Roman J (1994) Curso de Algebra y Geometra Alambra Longman, Madrid, Espana 63 Werner G (1981) Linear Algebra, ... 687726 Marrero-Ponce Y, Castillo-Garit JA, Olazabal E, Serrano HS, Morales A, Castanedo N, Ibarra-Velarde F, Huesca-Guillen A, Jorge E, del Valle A et al (2004) TOMOCOMD-CARDD, a novel approach for ... mathematical models These statistical analyses were carried out using the statistica software package [77] Forward stepwise was xed as the strategy for variable selection in the case of LDA and LMR analysis...

Ngày tải lên: 29/03/2014, 09:20

... significant hemolytic activity as well as the largest antimicrobial activity, yielded a ½hŠ208 =½hŠ222 even lower than that of native GGN4, as well M M as a larger j½hŠ222 j than that of native ... gray, respectively The direction of view is approximately perpendicular to the helical axis in panels A and B, and is parallel to the helical axis in panels C and D rapid exchange of the Hz amino ... GGN4, a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native...

Ngày tải lên: 31/03/2014, 09:20

... collection, analysis and interpretation of data ST, MTM and ARD: Design and critically revising of the manuscript All authors read and approved the final manuscript Acknowledgements AFIP, CNPq, CAPES, ... measure of self-evaluated change in health status in the past year [19] 3) BSQ- Body Shape Questionnaire – Translated into Portuguese and validated for the Brazilian population A 34item measure ... Carnier J, Lofrano MC, Prado WL, Caranti DA, de Piano A, Tock L, Nascimento CM, Oyama LM, Mello MT, Tufik S, Dâmaso AR: Hormonal alteration in obese adolescents with eating disorder: effects of...

Ngày tải lên: 18/06/2014, 18:20

... TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement for healthcare ... that the aim of the training programme was not to directly target weight loss for a reduction of cardiovascular risk, but instead to improve physiological capacity, and biomarkers of cardiovascular ... Pedersen BK: The anti-inflammatory effect of exercise: its role in diabetes and cardiovascular disease control Essays Biochem 2006, 42:105-117 Vasankari TJ, Kujala UM, Vasankari TM, Ahotupa M: Reduced...

Ngày tải lên: 20/06/2014, 00:20

... induced adverse reaction to Garcinia kola Conclusion: Garcinia kola appeared to have clinically significant analgesic/anti-inflammatory effects in knee osteoarthritis patients Garcinia kola is a potential ... The pharmacodynamic mechanism of Garcinia kola action is anchored on Kolaviron (KV) [[14-17], and [18]] Garcinia kola acts by restoring and maintaining the balance of fatty acids in osteoarthritis ... EO, Akanni OO, Emerole GO: Antioxidant and Scavenging activities of flavonoid extract (kolaviron) of Garcinia kola seeds Pharmaceutical Biology 2002, 40(2):107-16 Adaramoye OA, Nwaneri VO, Anyanwu...

Ngày tải lên: 20/06/2014, 01:20

... which was funded solely by Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA In addition, Amir Tavakkol and Farid Kianifard (Novartis Pharmaceuticals Corporation) and Monika Raut (employed ... Pharmaceuticals Corp The analysis for this study was conducted by Ovation Research Group Amir Tavakkol and Farid Kianifard are employees of Novartis Pharmaceuticals Corporation Monika Raut is an ... questionnaire at baseline and at the end of the study and who had measures of clinical efficacy (clinical assessment of target nail clearing and re-growth) Change scores were computed for each scale...

Ngày tải lên: 20/06/2014, 15:20

... panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’)2 fragments Panitumumab (Amgen) was ... M, et al: Cetuximab: Preclinical Evaluation of a Monoclonal Antibody Targeting EGFR for Radioimmunodiagnostic and Radioimmunotherapeutic Applications Cancer Biotherapy and Radiopharmaceuticals ... intact panitumumab Trastuzumab F(ab’)2 was used as a negative control All values were corrected for on a nanomolar basis The immunoreactivity of the 111 In-panitumumab F(ab’)2 was assessed in a...

Ngày tải lên: 21/06/2014, 02:20

... Finland, Germany, Denmark, Sweden, Rest of European Union Japan Japan China China, Hong Kong Korea Korea CER Australia, New Zealand Rest of Asia Taiwan, India, Sri Lanka, Rest of South Asia Rest ... significant market share in textiles and apparel and other manufactures TABLE Market Share of ASEAN and China in Selected Markets (Asian Crisis Simulation Result) SECTORS USA EU JAPAN ASEAN China ASEAN ... Nominal Devaluation and Rates of Inflation in ASEAN and Korea, 1997-99 REGION ASEAN Nominal Devaluation CPI Inflation Real Devaluation 67.3% 0% 14.3% Indonesia Malaysia Singapore Thailand Vietnam...

Ngày tải lên: 23/07/2014, 15:27

... throughfall was within the range of European data [30] but was rather high in comparison to a set of French data [83] Mean annual litterfall in the mature Douglas-fir stand was estimated at 1.7 tãha1ãyr1 ... Smith C.T., Microbial biomass C and N, and mineralizable-N, in litter and mineral soil under Pinus radiata on a coastal sand: Influence of stand age and harvest management, Plant Soil 175 (1995) ... discussed later) 2.5 Statistical analysis Each year, the annual fluxes were calculated by adding up the 13 4-week incubation period fluxes As in 1993 only summer month data are available, we calculated...

Ngày tải lên: 08/08/2014, 01:21

... steady-state value of A in Ca-deficient plants was reduced to half of the control A unique linear relationship found between A and the stomatal conductance to water vapour (g at steady ) w state ... was monitored on a leaf of three plants from each treatment A twig with six to eight leaves was cut under water, and after stabilisation of stomatal conductance, the shoot was transferred to a ... Hagiwara, 1989) The calcium deficiency in oak leaves resulted in an uncomplete stomatal closure under darkness Thus, we may state that decreased availability of calcium at leaf level 2+ probably...

Ngày tải lên: 08/08/2014, 18:21