... demographic and clinical data was obtained at baseline and prior to randomization QOL and self-efficacy were assessed at baseline and at 3, 6, and 12 months Eating behavior and depression was assessed ... only at baseline and 12 months QOL was measured by the Functional Assessment of Cancer Therapy-General (FACT-G), a valid and reliable questionnaire evaluating physical, functional, family-social, ... used repeated measures analysis of variance (ANOVA) with the 3, and 12 month data as outcomes and the appropriate baseline measurement as a covariate to test for the main effect of group (LI versus...
Ngày tải lên: 18/06/2014, 19:20
... collection, analysis and interpretation of data ST, MTM and ARD: Design and critically revising of the manuscript All authors read and approved the final manuscript Acknowledgements AFIP, CNPq, CAPES, ... 6:11 Hassan MK, Joshi AV, Madhavan SS, Amonkar MM: Obesity and health-related quality of life: A cross-sectional analysis of the US population Int J Obes 2003, 27:1227-1232 Kaukua J, Pekkarinen ... measure of self-evaluated change in health status in the past year [19] 3) BSQ- Body Shape Questionnaire – Translated into Portuguese and validated for the Brazilian population A 34item measure...
Ngày tải lên: 18/06/2014, 18:20
báo cáo khoa học: " Getting the message straight: effects of a brief hepatitis prevention intervention among injection drug users" pps
... Koester, Ismael Janie Simmons, Kim Koester, Ismael Nuñez, Rachel Sayko and Susan Fabian in Hartford; Askia Muhammad, Sybil Marcus, Jon Paul Hammond, Jennifer Awa, Daryl Gault, Donny Gann, Jeffrey ... instructions about appropriate use of these materials Injectors may be unaware of the anticoagulation property of alcohol, instead believing that postinjection swabbing with alcohol protects against ... sample was 59.6% male, 92.8% from racial/ethnic minority groups, and predominantly heroin injectors The mean age was 41.4 years (SD 9.0), and 12.2% had less than a 9th-grade education On average,...
Ngày tải lên: 11/08/2014, 18:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... 1317813188 Maithal K, Ravindra G, Balaram H & Balaram P (2002) Inhibition of Plasmodium falciparum triosephosphate isomerase by chemical modication of an interface cysteine: electrospray ionization mass ... GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors Journal compilation ê 2009 FEBS M Banerjee et al ... 441456 Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme Pure Appl Chem 77, 281289 Parthasarathy S, Ravindra G, Balaram H, Balaram P & Murthy...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot
... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... PRMT reaction, the use of SAM analogs is a logical strategy for the direct inhibition of PRMTs As a SAM analog, sinefungin can compete for SAM binding and inhibit the activity of all SAM-dependent ... Bonham et al 11 Clarke SG (2006) Inhibition of mammalian protein methyltransferases by 5¢-methylthioadenosine (MTA): a mechanism of action of dietary SAMe? In The Enzymes: Protein Methyltransferases...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
... tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal model of septic ... IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ± SD The significance of the results was assessed ... protein sequence Angle, the calculated angle between the helix axis and the plane of a model membrane ASA, accessible surface area +, the peptide has an adequate mean surface accessibility ‡ 30%...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... same Ala substitution was reported to cause a significant decrease in biological activities of [Ala8]NKA measured in human tissues [44] Indeed, [Ala8]NKA(4–10) was shown to be a weak partial agonist ... solvent variation, causing an underestimation of calculated CSDs These CSDHa and CSDCa variations demonstrate the formation of more stable and abundant helical structures for [Aib9]SP than for ... 180°, cannot overlap any conformation of a- amino acids In order to visualize on the potential energy surfaces the conformers of b-amino acids that fit with canonical conformations of a- amino acids,...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... physiological consequence Again, the ADAM10 transgenes remained without effect in all investigated mouse lines (Fig 5A) G-ratios of ADAM10mo as well as of ADAM10dn mice at postnatal day 17 were identical...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt
... Geometra Cartesiana 2nd edn McGraw-Hill Interamericana de Espana, Madrid 62 de Burgos-Roman J (1994) Curso de Algebra y Geometra Alambra Longman, Madrid, Espana 63 Werner G (1981) Linear Algebra, ... 687726 Marrero-Ponce Y, Castillo-Garit JA, Olazabal E, Serrano HS, Morales A, Castanedo N, Ibarra-Velarde F, Huesca-Guillen A, Jorge E, del Valle A et al (2004) TOMOCOMD-CARDD, a novel approach for ... mathematical models These statistical analyses were carried out using the statistica software package [77] Forward stepwise was xed as the strategy for variable selection in the case of LDA and LMR analysis...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
... significant hemolytic activity as well as the largest antimicrobial activity, yielded a ½h208 =½h222 even lower than that of native GGN4, as well M M as a larger j½h222 j than that of native ... gray, respectively The direction of view is approximately perpendicular to the helical axis in panels A and B, and is parallel to the helical axis in panels C and D rapid exchange of the Hz amino ... GGN4, a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo hóa học: " Effects of a robot-assisted training of grasp and pronation/supination in chronic stroke: a pilot stud" pot
... hemorrhagic left basal ganglia A2 68 M 1064 34 hemorrhagic right basal ganglia A3 48 M 323 13 hemorrhagic left basal ganglia A4 46 M 679 34 ischemic right temporal, basal ganglia, corona radiata, ... basal ganglia A9 43 F 417 37 hemorrhagic* right frontal lobe A1 0 71 F 318 40 ischemic A1 1 65 F 271 33 ischemic* right corona radiata, basal ganglia right basal ganglia, corona radiata, external ... external capsule frontal-parietal, thalamus A1 2 31 M 297 35 hemorrhagic right parietal lobe A1 3 55 M 480 14 hemorrhagic right basal ganglia A1 4 44 F 627 41 hemorrhagic left basal ganglia A1 5 32...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf
... TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement for healthcare ... Pedersen BK: The anti-inflammatory effect of exercise: its role in diabetes and cardiovascular disease control Essays Biochem 2006, 42:105-117 Vasankari TJ, Kujala UM, Vasankari TM, Ahotupa M: Reduced ... that the aim of the training programme was not to directly target weight loss for a reduction of cardiovascular risk, but instead to improve physiological capacity, and biomarkers of cardiovascular...
Ngày tải lên: 20/06/2014, 00:20
The effects of a RMB devaluation on ASEAN economies
... Finland, Germany, Denmark, Sweden, Rest of European Union Japan Japan China China, Hong Kong Korea Korea CER Australia, New Zealand Rest of Asia Taiwan, India, Sri Lanka, Rest of South Asia Rest ... significant market share in textiles and apparel and other manufactures TABLE Market Share of ASEAN and China in Selected Markets (Asian Crisis Simulation Result) SECTORS USA EU JAPAN ASEAN China ASEAN ... Nominal Devaluation and Rates of Inflation in ASEAN and Korea, 1997-99 REGION ASEAN Nominal Devaluation CPI Inflation Real Devaluation 67.3% 0% 14.3% Indonesia Malaysia Singapore Thailand Vietnam...
Ngày tải lên: 23/07/2014, 15:27
Báo cáo lâm nghiệp: "Effects of a clear-cut on the in situ nitrogen mineralisation and the nitrogen cycle in a 67-year-old Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) plantation" potx
... throughfall was within the range of European data [30] but was rather high in comparison to a set of French data [83] Mean annual litterfall in the mature Douglas-fir stand was estimated at 1.7 tãha1ãyr1 ... Smith C.T., Microbial biomass C and N, and mineralizable-N, in litter and mineral soil under Pinus radiata on a coastal sand: Influence of stand age and harvest management, Plant Soil 175 (1995) ... discussed later) 2.5 Statistical analysis Each year, the annual fluxes were calculated by adding up the 13 4-week incubation period fluxes As in 1993 only summer month data are available, we calculated...
Ngày tải lên: 08/08/2014, 01:21
Báo cáo lâm nghiệp: "Effects of a calcium deficiency on stomatal conductance and photosynthetic activity of Quercus robur seedlings grown on nutrient solution" pdf
... steady-state value of A in Ca-deficient plants was reduced to half of the control A unique linear relationship found between A and the stomatal conductance to water vapour (g at steady ) w state ... was monitored on a leaf of three plants from each treatment A twig with six to eight leaves was cut under water, and after stabilisation of stomatal conductance, the shoot was transferred to a ... Hagiwara, 1989) The calcium deficiency in oak leaves resulted in an uncomplete stomatal closure under darkness Thus, we may state that decreased availability of calcium at leaf level 2+ probably...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo lâm nghiệp: "Contribution of different solutes to the cell osmotic pressure in tap and lateral roots of maritime pine seedlings: effects of a potassium deficiency and of an all-macronutrient deficienc" pptx
... of a bunch of primary leaves), of the tap root (TR) and of the three longest lateral roots (LR; as an assessment of the length of the lateral roots) of each plant were measured just before harvest ... detection and an autosuppression recycle mode (Dionex DX 300, Sunnyvale, USA) This was associated with an automatic were 2.4.3 Amino-acid analysis Extraction was carried out at °C 40 μL of internal ... (TRPA) and to the apex of the lateral roots (LRA), the apex of the tap root (TRA) seemed to be protected: [K] decreased less, π was perfectly maintained and there was no Na accumulation Logically,...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo y học: "Circadian phase-shifting effects of a laboratory environment: a clinical trial with bright and dim light" ppsx
... ages 20–40), mean and SE Age Group Baseline aMT6s Acrophase Final aMT6s Acrophase Baseline Circadian Malsynch Final Circadian Malsynch Baseline Circadian Dispersion Final Circadian Dispersion ... Journal of Circadian Rhythms 2005, 3:11 Figure Circadian malsynchronization at baseline and final assessment Circadian malsynchronization at baseline and final assessment Shown is circadian malsynchronization, ... differed, on average, by 0.03 hours Baseline aMT6s acrophase was compared across treatment and age group via × ANOVA Final aMT6 acrophase was determined from urinary data collected during the final 24–30...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps
... amount of data is available related to long-term side effects and toxicity [1,21] A limitation of this study is that only acute and earlystage effects of ABS were evaluated Long-term anastomosis patency ... 1, and the most prominent staining reaction Page of covering nearly the whole area of the specimen was classified as Grade was intermediate between and Statistical analysis Statistical analyses ... hemostasis Aortic sampling was performed in all rats to search for immediate and Day-7 postoperative histopathological changes in vascular tissues as a result of ABS Bleeding assay The duration of...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx
... scoring the biomedical items in the abstraction instrument All available values over three years were obtained and afterwards a mean per patient per year was calculated Data abstractors were blinded ... baseline, one year and two years follow up We extracted patient outcomes and professional performance data from medical records and patient survey, as well as data about structural aspects of ... multifaceted implementation approach emphasizing collaborative learning and exchange of insights and support among a set of healthcare organizations, like a quality improvement collaborative...
Ngày tải lên: 10/08/2014, 10:23
A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx
... [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management of diabetes in Canada Canadian Medical Association Journal ... 25:301-318 Damanpour F: Organizational innovation: A meta-analysis of effects of determinants and moderators Academy of management journal 1991, 34:555-588 Elenkov DS, Manev IM: Top management leadership ... to track individual participant and chart audit data Names of interview participants will be kept separated from data collection forms and locked at the University of Ottawa Nursing Best Practice...
Ngày tải lên: 11/08/2014, 05:21