Regulation of the TRIP BR1 proto oncoprotein a potential therapeutic target for human cutaneous and intracavitory proliferative lesions
... cutaneous and intracavitary superficial mucosal lesions such as vulvar intraepithelial neoplasia, cervical dysplasia or carcinoma in situ, oral cancer and nasopharyngeal bladder cavity mucosal ... studies of the integrator function of TRIP- Br transcription factor as therapeutic drug target for the treatment of human cutaneous and intracavitary superficial lesio...
Ngày tải lên: 12/09/2015, 08:19
... presence of AMP (0, 50, 200 or 500 lM AMP) Table Effect of the mutations in the AMPK c3 gene on the AMP dependence of the enzyme Fold stimulation reflects the activation of the corresponding AMPK complexes ... AICAR- and contraction-induced a2-AMPK signaling [49] Initially, AMP was thought to increase phosphorylation of AMPK by AMPKK both by direct...
Ngày tải lên: 30/03/2014, 08:20
... inactivation of c-aminobutyric acid transaminase by gabaculine and more recently by others for the inactivation of c-aminobutyric acid transaminase [32], d-amino acid aminotransferase [33], and ... various AdoMet and KAPA concentrations n 20 lM KAPA; h 50 lM KAPA; d 70 lM KAPA; s 100 lM KAPA; r 140 lM KAPA (B) Replot of the ordinate intercepts against KAPA concentrations Data we...
Ngày tải lên: 07/03/2014, 11:20
Post translational regulation of the human TRIP br1 cell cycle protein
... weight of 25.1 kDa and a pI of ~3.99 The murine TRIP- Br1 (mTRIP -Br1) orthologue is 86% identical to hTRIP -Br1 in amino acid sequence The other TRIP- Br family member, the human TRIP- Br2 (hTRIP-Br2) ... binding region of DP1 60 5.4 Other TRIP- Br1 binding partners - the p53 oncoprotein 61 5.5 50 Other TRIP- Br1 binding partners - the E6 oncoprotein 63 TRIP-...
Ngày tải lên: 14/09/2015, 13:56
Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc
... importance as the guardian of the cell cycle and its clinical relevance in human cancers, structural and thermodynamic understanding of the mechanisms of action of the Rb protein is far behind that of ... denote the position of FITC moieties (B) Association of E7( 1-40) and RbAB at 200 nM E7( 1-40) (C) Association of E7( 1-40) and the RbAB domain at...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTA...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... expressing the recombinant mPC1 ⁄ 3, the presence of the 87 kDa form in excess of the 66 ⁄ 71 kDa facilitates isolation of the enzyme and helps in maintaining the enzymatic activity at a proper ... Bernard N, Kitabgi P & Rovere-Jovene C (20 03) The Arg617–Arg618 cleavage site in the C-terminal domain of PC1 plays a major role in the processing and...
Ngày tải lên: 30/03/2014, 08:20
Accompanying the document Proposal for a REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on European Social Entrepreneurship Funds doc
... practices for social businesses or the creation of a database for existing labels and certifications of social enterprises, to measures aiming to strengthen the professionalism and managerial capacities ... Employment, Social Affairs and Inclusion, Health and Consumer Protection, Internal Market and Services, Taxation and Customs Union, the Secretariat Genera...
Ngày tải lên: 30/03/2014, 12:20
Báo cáo y học: "Early down-regulation of the pro-inflammatory potential of monocytes is correlated to organ dysfunction in patients after severe multiple injury: a cohort study" pptx
... reasonable to assume that the intensity of monocytic temporal paralysis, that is, the diminished capacity to release proinflammatory cytokines in response to LPS, is in direct proportion to the ... hours after admission In our opinion these findings reflect either the above mentioned refractory state of monocytes towards endotoxin challenge already having rele...
Ngày tải lên: 13/08/2014, 16:21
A functional genomics approach for elucidation of novel mechanisms involved in GnRH regulation of the gonadotropins
... A FUNCTIONAL GENOMICS APPROACH FOR ELUCIDATION OF NOVEL MECHANISMS INVOLVED IN GnRH REGULATION OF THE GONADOTROPINS By LUO MIN (B SC.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... regulate the synthesis of the gonadotropins directly at the pituitary or indirectly at the hypothalamus by modulating GnRH secretion The gon...
Ngày tải lên: 11/09/2015, 21:47
Reactive oxygen species mediated regulation of the na+ h+ exchanger, NHE 1 gene expression a new mechanism for tumor cells resistance to apoptotic cell death
... I.5 Na+- H+ Exchanger (NHE) The Na+- H+ exchangers (NHEs) are a family of membrane glycoproteins which transport H+ out of the cell in exchange for Na+ with a stoichiometry of 1: 1 In mammalian cells, ... increased 11 2 susceptibility to cell death IV .12 Regulation of intracellular pH as one of the mechanisms of 11 3 NHE- 1 -mediated cell...
Ngày tải lên: 16/09/2015, 08:31
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
... loudspeakers and paging system, and a detailed log of all calls is maintained Criteria for medical emergency team activation Calling criteria for our MET service are based on acute changes in heart ... drugs and defibrillators Outcome measures Information on the activation of all MET calls is maintained on a hospital switchboard logbook that includes the date and time...
Ngày tải lên: 25/10/2012, 10:45
Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc
... (2001) Roles of ¨ the heat shock transcription factors in regulation of the heat shock response and beyond FASEB J 15, 1118–1131 Fujimoto M & Nakai A (2010) The heat shock factor family and adaptation ... In accordance with the fundamental role of HSF1 in the heat shock response, the requirement of HSF1 and HSF4 in development of the lens and olfa...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
... Mima J, Hayashida M, Fujii T, Hata Y, Hayashi R & Ueda M (2004) Crystallization and preliminary X-ray analysis of carboxypeptidase Y inhibitor IC complexed with the cognate proteinase Acta Crystallogr ... Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K & Araki T (2005) FD, a bZIP protein mediating signals from the floral path...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL doc
... relevance) THE EUROPEAN PARLIAMENT AND THE COUNCIL OF THE EUROPEAN UNION, Having regard to the Treaty on the Functioning of the European Union, and in particular Article 114 thereof, Having regard to the ... either by the European Parliament or the Council within a period of two months of notification of that act to the European Parliament...
Ngày tải lên: 19/02/2014, 14:20