Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 1

Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 1

Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 1

... Transition state geometries and barriers for methane activation on Ni (11 1), Ni (11 1)-CSS and Ni (11 1)-BSS surfaces 11 3 Table 5.4 Methyl and hydrogen binding energies (kJ/mol) for the Ni( 211 ) surface, the ... Model used to calculate the stability of small graphene islands on the Ni (11 1) surface Black and grey circles indicate saturated, internal graphene atoms with...
Ngày tải lên : 11/09/2015, 16:06
  • 18
  • 257
  • 0
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 2

Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 2

... (Xu and Saeys, 20 06) have been proposed and shown to improve the stability of Ni catalysts The objective of this thesis is to design a promoter to enhance the stability of Ni-based catalysts Thermodynamic ... understanding of the elementary steps and the origin of catalyst promotion, as well as to the design of a new, improved catalyst Th...
Ngày tải lên : 11/09/2015, 16:06
  • 159
  • 575
  • 0
Báo cáo hóa học: " A Proxy Architecture to Enhance the Performance of WAP 2.0 by Data Compression" ppt

Báo cáo hóa học: " A Proxy Architecture to Enhance the Performance of WAP 2.0 by Data Compression" ppt

... realistic networks using real WAP traffic Also, since WAP 2.0 has been newly released, there has not been any comparison of the performance of WAP 2.0 stack against WAP 1.x stack in the literature ... In WAP 1.x, a content encoding approach is used at the WAP gateway to compress the data Although WAP 2.0 is an evolutional step forward, by adopting the...
Ngày tải lên : 23/06/2014, 00:20
  • 10
  • 432
  • 0
báo cáo khoa học: " Comparison of hyperthermia and adrenaline to enhance the intratumoral accumulation of cisplatin in a murin model of peritoneal carcinomatosis" potx

báo cáo khoa học: " Comparison of hyperthermia and adrenaline to enhance the intratumoral accumulation of cisplatin in a murin model of peritoneal carcinomatosis" potx

... this article as: Facy et al.: Comparison of hyperthermia and adrenaline to enhance the intratumoral accumulation of cisplatin in a murin model of peritoneal carcinomatosis Journal of Experimental ... uptake of platinum in peritoneal nodules and in peritoneum lining muscle when adrenaline was used in combination with cisplatin, as compared...
Ngày tải lên : 10/08/2014, 10:20
  • 8
  • 346
  • 0
Báo cáo y học: " Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map" doc

Báo cáo y học: " Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map" doc

... from the dictionary map This is referred to as the complementary map Validation of the combined map formed by amalgamating the complementary map with the current dictionary map This combined map ... referred to as the ‘enhanced map The performance of the enhanced map was evaluated against the performance of the dictionary map alone by using d...
Ngày tải lên : 13/08/2014, 23:20
  • 13
  • 688
  • 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... qualities, brand loyalty, brand awareness, brand association and other propriety assets According to him, Brand loyalty has to with the level of...
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...
Ngày tải lên : 19/02/2014, 17:20
  • 12
  • 616
  • 0
Tài liệu ENGLISH SECOND LANGUAGE LEARNERS: USING MUSIC TO ENHANCE THE LISTENING ABILITIES OF GRADE ONES ppt

Tài liệu ENGLISH SECOND LANGUAGE LEARNERS: USING MUSIC TO ENHANCE THE LISTENING ABILITIES OF GRADE ONES ppt

... language, music, movement, hearing, listening skills xiv ENGLISH SECOND LANGUAGE LEARNERS: USING MUSIC TO ENHANCE THE LISTENING ABILITIES OF GRADE ONES CHAPTER STATEMENT OF THE PROBLEM AND METHOD OF ... if they not continue to develop their first language alongside the second language According to various theorists, the teaching of Englis...
Ngày tải lên : 24/02/2014, 18:20
  • 242
  • 648
  • 1
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal- regulated kinase ... Morphological study of the mammalian stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear...
Ngày tải lên : 07/03/2014, 12:20
  • 10
  • 452
  • 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

... crockery, glassware & cutlery where possible (to reduce waste) This is part of Greener Events , a guide on reducing the environmental impacts of conferences and seminars There are also companion guides ... suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager by the event mana...
Ngày tải lên : 16/03/2014, 19:20
  • 5
  • 527
  • 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... present  the results  of an  application  of MCA  to find  out  the most  feasible measures for sustainable development of the brackish water shrimp culture in Quang Tri Province. The application of MCA  ... pond  area  in the province. As shown in Fig. 2, the total area of brackish water shrimp culture has  increased  approximately 4 times, from 251 ha in 2000 to 902.5 ...
Ngày tải lên : 22/03/2014, 12:20
  • 13
  • 487
  • 0
hacking vim a cookbook to get the most out of the latest vim editor

hacking vim a cookbook to get the most out of the latest vim editor

... Development Editor Nanda Nag Indexer Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali ... platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor The combination o...