use a helper to format the price

A numerical study on the use of geofoam to increase the external stability of reinforced soil walls

A numerical study on the use of geofoam to increase the external stability of reinforced soil walls

... studies (Hatami and Bathurst 2005) that an equivalent static vertical load may be used to approximate the effects of compaction on lateral earth pressure in the backfill and on wall facing deformation ... Section The program Fast Lagrangian Analysis of Continua (FLAC; Itasca 2005) was used to carry out the numerical simulations FLAC is suitable for modeling problems that involve large deformation and ... prototype walls tested in a controlled laboratory environment (Hatami and Bathurst 2005, 2006; Hatami et al 2005; Bathurst and Hatami 2006) A backfill width -to- height ratio of to was adopted to

Ngày tải lên: 18/05/2021, 17:26

19 7 0
how ants use quorum sensing to estimate the average quality of a fluctuating resource

how ants use quorum sensing to estimate the average quality of a fluctuating resource

... Nigel R. Franks1,*, Jonathan P. Stuttard1,*, Carolina Doran1,2, Julian C. Esposito1, Maximillian C. Master1, Ana B. Sendova-Franks3, Naoki Masuda4 & Nicholas F. Britton5 We show that one of the advantages ... trade-offs may also occur when the alternatives are constant because discriminating among them accurately can depend on gathering sufficient information and that takes time Such speed vs accuracy trade-offs ... just the Ratio of good vs poor quality for the fluctuating nest as a fixed factor predictor and Colony ID as the random factor, the likelihood of the ant colonies choosing the Fluctuating rather

Ngày tải lên: 04/12/2022, 10:37

12 0 0
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 1

Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 1

... by carbon atoms. VI Calculations indicate that boron atoms preferentially bind at the step sites and at octahedral sites just below the surface. Boron and carbon atoms hence show similar a relative ... preferred adsorption sites for carbon atoms and can act as nucleation sites for the formation of graphene islands. On-surface carbon atoms are relatively unstable with binding energies of around ... lower the methane dissociation barrier from 101 kJ/mol to 64 kJ/mol. Hence, boron atoms are believed to enhance the catalyst stability and not reduce the catalyst activity. In order to validate

Ngày tải lên: 11/09/2015, 16:06

18 258 0
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 2

Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 2

... that was proposed in the homogeneous literature. The only difference here is that the availability and participation of other surface metal atoms that can assist the reaction on the surface. The ... oxygen atom, abstracts a hydrogen atom from the approaching CH4, since the O2 precursor state is stable on a Ni catalyst. Theory could be used to distinguish these mechanisms. To evaluate the relative ... components Finally, they used a Co3Mo3N catalyst to demonstrate experimentally that this alloy has an ammonia synthesis activity comparable to that of the best industrial catalysts (Jacobsen

Ngày tải lên: 11/09/2015, 16:06

159 576 0
A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV)   induced reactive oxygen species (ROS) production in u937 cells

A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV) induced reactive oxygen species (ROS) production in u937 cells

... 123-132 37 Komatsu, D., Kato, M., Nakayama, J., Miyagawa, S., and Kamata, T (2008) NADPH oxidase plays a critical mediating role in oncogenic Ras-induced vascular endothelial growth factor expression ... Wondrak, G (2009) Redox-directed cancer therapeutics: molecular mechanisms and opportunities Antioxid Redox Signal 11, 3013-3069 72 Yamamoto, T., Sakaguchi, N., Hachiya, M., Nakayama, F., Yamakawa, ... minutes and the ROS production was analyzed by the DCFDA assay using the LSC The control (untreated) cells are represented in red as an overlay in the histograms 10ng/ml PMA was used as a positive

Ngày tải lên: 26/09/2015, 10:44

110 528 0
Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems

Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems

... UWBST and IWUWBS 2004, May 2004 5 [3] S Niranjayan, A Nallanathan and B Kannan, A New Analytical... standardization Different performance measures are available to evaluate communication ... recover the information successfully. In fading channels, where the instantaneous SNR is a random variable, the average SNR is used as the measure. Another standard measure in fading channels is the ... Furthermore, the channel gain is modeled as a log-normal random variable. Therefore, in order to make the analysis theoretically tractable, certain simplifying assumptions are made. The channel

Ngày tải lên: 05/10/2015, 22:04

104 421 0
AN1050   a technique to increase the frequency resolution of PICmicro® MCU PWM modules

AN1050 a technique to increase the frequency resolution of PICmicro® MCU PWM modules

... cycle ; then init the FRACTIONAL divider for the demo movlw IFRAC movwf FRAC ; init the fractional period part ; clear the fractional accumulator clrf FACC ; clear the accumulator ; then init the ... update the next period value ; > for demonstration only bcf isre retfie ; clear the interrupt flag ; add the FRAC to the accumulator ; get the base period value in W ; if there was a carry in the ... on-chip hardware and software The provided code example generates a 100 kHz signal that can be adjusted in steps of 64 Hz, while using only 13% of the available CPU cycles thanks to the use of the

Ngày tải lên: 11/01/2016, 16:37

10 194 0
Development of a model to calculate the economic implications of improving the indoor climate

Development of a model to calculate the economic implications of improving the indoor climate

... performance tasks indicating that the two tasks to some extent measured the same dimension of mental performance The analysis seems superior to conventional univariate analysis and the information ... by occupants who are used to mechanical cooling Since the thermal BN model was based on the same data used to derive the adaptive comfort model, this difference in thermal sensation based on ... Lars also gave valuable practical input during the project period and together with my other colleagues at Alectia A/ S established a research environment that was inspiring I want to thank Professor

Ngày tải lên: 12/12/2016, 20:32

149 256 0
The economist WHat a way to run the world

The economist WHat a way to run the world

... government had already cracked down in what was then East Pakistan Hundreds of thousands of refugees had crossed the border into India Mrs Gandhi wanted the army to invade Pakistan General Manekshaw resisted ... five Lebanese prisoners The deal could pave the way for Israel to the same with Hamas, the Islamist movement that controls Gaza See article The usual suspect Anwar Ibrahim, leader of the opposition ... Homosexuality in India Amazon worldwide bestsellers Glad to be gay (but a bit shy about it) Fearless Malaysia Lewis Carroll Here we go again Shoes and ships and sealing wax Australia’s aborigines Family

Ngày tải lên: 30/03/2017, 14:17

163 362 0
A guide to getting the best health care for your child

A guide to getting the best health care for your child

... Medicine and Rehabilitation, and a Clinical Associate in Physiatry at Brigham & Women’s Hospital and Massachusetts General Hospital She is also Medical Director at Spaulding Outpatient Center as well ... characteristics and history and physical exam, how many of them have the illness that’s detected by the test? The chance of a child truly having disease, or the posttest probability, is calculated ... how accurate they are These characteristics answer the questions “Among a group of people who have a condition, how many of them will have a positive test?” (the sensitivity) AND “Among a group

Ngày tải lên: 16/01/2018, 08:56

194 355 0
Creating sales stars a guide to managing the millennials on your team

Creating sales stars a guide to managing the millennials on your team

... watched them move the sales needle upward almost immediately Many of my past employees comment to me that his books and training continue to have an impact on their sales careers and their lives ... environment to communicating in a manner that translates to employees of all generations, Creating Sales Stars is the one book you need to retain your best people and get them fired up to make sales ... empathy, personalize relationships, communicate, and make others better—all are translated into proven techniques that will create sales stars Wonderful ideas not just for Millennials and salespeople,

Ngày tải lên: 20/01/2020, 08:21

148 42 0
Hashtags as a way to expedite the zakat supply chain

Hashtags as a way to expedite the zakat supply chain

... the zakat supply chain Caturida Meiwanto Doktoralinaa*, Zakaria Baharib, Shahir Akram Hassanb, Nor Asmat Ismailc and Sri Ayu Lailatul Mardiyahd a Faculty of Business and Economics, Universitas ... ‘@zakatUS with #zakatmalaysia and #zakatindonesia and @zakatsg with #zakatbruneidarussalam.’ With the number of social media users increasing, it is likely that the #zakat hashtag could be a critical ... Zakat hashtags play a major role in increasing Zakat awareness, represent a significant contribution to increasing awareness of Zakat payments among the general public Zakat awareness and marketing

Ngày tải lên: 26/05/2020, 22:57

10 18 0
Development of a scale to measure the perception and acceptance of information technology (IT) enabled comprehensive farm advisory services by farmers

Development of a scale to measure the perception and acceptance of information technology (IT) enabled comprehensive farm advisory services by farmers

... TAB we can get any information at any time We have to wait for the field staff to get information from TAB Accuracy The information includes recommendations by University and ICAR The information ... standing gap with the following objectives Hence, the research was taken with an objective to develop and standardize a scale to measure the perception and acceptance of farmers about information ... for the item analysis In item analysis the selected statements were administered to 40 farmers in non-sample area of Navalgund taluk in Dharwad district of Karnataka state during 2018-2019 Finally

Ngày tải lên: 20/09/2020, 19:50

10 15 0
A study to assess the effectiveness of constructed wetland technology for polluted surface water treatment

A study to assess the effectiveness of constructed wetland technology for polluted surface water treatment

... especially in the reed planting trial In particular, the treatment efficiency of pollutants such as TSS, BOD 5, COD reached a high rate of 85%, 90%, and 87%, respectively In addition, ANOVA statistical ... microorganisms (fecal coliform) which aim to protect the water quality and aquatic ecosystems The results showed the treatment effectiveness of loading of 500mL/min/m2 is higher than the loading ... Abstract: The study aims to assess the applying effectiveness of constructed wetland technology for polluted surface water treatment The experimental models were operated with hydraulic loadings

Ngày tải lên: 25/09/2020, 11:22

12 25 0
Using multi criteria analysis as a tool to select the feasible measures íor sustainable development of brackish water shrimp culture in quang tri province

Using multi criteria analysis as a tool to select the feasible measures íor sustainable development of brackish water shrimp culture in quang tri province

... peraturc usually h ap p en s on July and January7 respcctively Q uang Tri has a total annual rainíall of about 2000-2700 m m , but the rainíall is rather unequally distributed over từ ne and spacc ... and their solutions can be rcached Hovvever, it is noted that MCA is subjective in its nature In case the quantitative d ata are available, quantitative analysis (i.e num erical modelling) can ... and accounts íor 75% to 85% of the total yearly rainíall, vvhcrcas tho dry scason lasts up to m onths, from Fobruary to July and occupies only 15-25% of the total rainíall 67 This leads to tho

Ngày tải lên: 17/03/2021, 20:39

13 3 0
A study to assess the potential impact of voluntary partnership agreement vpa to the livelihood of local people in dong xa commune na ri district bac kan province

A study to assess the potential impact of voluntary partnership agreement vpa to the livelihood of local people in dong xa commune na ri district bac kan province

... for 43.6% of the natural land With varied terrain, tropical climate has changed from North to South, it has created a diversity of natural ecosystems and the abundance of the species These ecosystems ... purchasing and transportating of timber / wood wood manufacturing process 5- others ( clearly)…… How many Agricultural land area your family have? what are species often cultivated? The annual ... Industry in Papua New Guinea” Asia-Pacific Action Group Hobart Australia Barbier, E, Burgess, J, Bishop, J, Aylward, B (1994).? ?The Economics of the Tropical Timber Trade”, Earthscan, London Callister,

Ngày tải lên: 08/04/2021, 08:49

73 9 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together ... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...

Ngày tải lên: 24/09/2012, 17:19

88 986 8
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... such a typical scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways,...

Ngày tải lên: 07/03/2014, 12:20

10 452 0
Money and happiness a guide to living the good life

Money and happiness a guide to living the good life

... importantly, understand how to manage it so it maximizes their happiness They have defined the good life” in a way that’s authentic to them, and use money to realize a personal vision Back in the 1990s, ... 2002, meaning they lack the means to ensure themselves of healthy meals and are vulnerable to at least a mild form of chronic malnutrition.3 WEALTH AND VALUES I live in a home that has heat and running ... excited to read the Financial Times,” she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial...

Ngày tải lên: 12/03/2014, 14:51

258 358 0
w