david lindsay a voyage to arcturus the original classic edition

... Gazing up, he saw six windows, one above the other at equal distances, all on the cast face - that is, overlooking the sea. Realising that no satisfaction was to be gained here, he came away again, ... two, the road parted from the sea coast and swerved sharply inland, across the hills. With Nightspore as guide, they left it and took to the grass. A faint sheep path marked the way along the ... toward the brightest star in the south- eastern sky. "There you see Arcturus, and Tormance is its one inhabited planet." Maskull looked at the heavy, gleaning star, and again at Krag....

Ngày tải lên: 06/03/2014, 14:20

... soon passed away. Two days afterwards, another paragraph appeared in the same paper, in these words: "We are credibly informed, that the supposed diamond of the famous traveller to the Moon, ... were like small filaments of silver; the Red Sea resembled a narrow plate of the same metal. The peninsula of India was of a darker, and Arabia of a light and more grayish green. The sun's rays ... think, then," said I, "that the native of Kamtschatka has the advantage?" 33 Chapter 4 Continuation of the voyage View of Europe; Atlantic Ocean; America— Spec- ulations on the future...

Ngày tải lên: 17/02/2014, 09:20

... different meaning attached to it; a brand can be defined as a name, logo, symbol and identity or a trademark. Prasad and Dev. (2000) also states that a brand can be seen to include all tangible and ... and trained staffs”. Therefore MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes. Max hamburger had a larger standard ... provided by a product or service to a firm and/or to that firm’s customers”. Brand loyalty Aaker (1991 p.39) defined Brand loyalty as the attachment that a customer has to a brand”. It can also be...

Ngày tải lên: 24/09/2012, 17:19

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified. ... pattern. By coregulating PK and LDH cells can maintain homolactic fermenta- tion. The fact that the effects of PK and LDH almost cancel each other out may also add to the explanation of why the...

Ngày tải lên: 19/02/2014, 17:20

... [13]. The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... highlighted above conceivably also operate in the present case. The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity. Enhanced Ras maturation by heat stress was associated ... stimulation [36]. Given the importance of the plasma membrane in link- ing growth factor receptor activation to the signaling cascade, it is likely that any alteration in surface mem- brane fluidity...

Ngày tải lên: 07/03/2014, 12:20

... she says with a laugh. When she was 14, her parents started a restaurant, and she began waitressing at night. Her father encouraged her to save up for substantial needs, like a car, rather than ... mother had the last laugh,” Deb says. “She has had a fabulous retirement, she and her boyfriend ride around [Florida’s] intercoastal waterway on their yacht. My father had health setbacks and ... incomes are miles apart, Marilyn N. and Julie D. have much in common. They have discovered the secret to financial happi- ness: aligning their money and values. What does this mean? They are clear...

Ngày tải lên: 12/03/2014, 14:51

... 2010 A Strategy to Engage th e Private Sector in Climate Change Adaptation in Bangladesh in Bangladesh 44 Appendix 2: The Bangladesh Climate Change Action Plan The Climate Change Action ... Lack of Data and Forecasting At a practical level, for climate change related insurance products to develop in Bangladesh, good data and forecasts and modelling capabilities are critical. ... the data are not available to enable insurers to assess the risks properly. The increasing frequency of climate-related events requires new models to interpret the data that is available and...

Ngày tải lên: 16/03/2014, 14:21

... used to help select a suitable venue and to aid planning discussions with management and staff at the venue. A copy should be passed to the venue manager by the event manager. The ... helping to reduce the need to travel for small meetings. However for conferences and seminars, where there is a specific need to gather many delegates and speakers together in one place, there are ... events are as follows: 1. Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities. Other facilities or amenities in the area and appropriateness...

Ngày tải lên: 16/03/2014, 19:20

... July and January,respectively. Quang Tri has a total annual rainfall of about2000‐2700mm, but the rainfallisrather unequally distributed over time and space. The rainyseasonstartsinSeptember,endsin NguyenTienGiangetal./VNUJournalofScience,EarthSciences24(2008)66‐78 ... scientistsis to screen amongthese alternatives the feasiblemeasures based on applicability and suitability for the localconditions. 2.4.Evaluationcriteria After the problemanditsconstraintshave beendetermined, the setofevaluationcriteria should ... their living; they need to maintain their families. Also because of the relative large initial investmentcoststheyareindebtandhave to repay the banksinshortterms. The ...

Ngày tải lên: 22/03/2014, 12:20

... Hence, adding an icon to the toolbar is just like adding an item to a menu. In the case of a 'toolbar menu', you will be able to add items to it by using a menu-path that starts with the ... in other applications; rather they are a way to group your open les. Each tab can contain several open buffers and even several windows at the same time. What makes tabs special is that the ... Schulz Reviewers Brian Jørgensen James Eaton-Lee Kenneth Geisshirt Sven Guckes Development Editor Nanda Nag Nikhil Bangera Technical Editor Ajay S Editorial Manager Dipali Chittar Project Manager Patricia Weir Project...

Ngày tải lên: 01/06/2014, 10:43

... coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper. ED performed data cleaning and data analysis. SM contributed to data analysis, writing of the manuscript, ... international goal to achieve universal access to HIV/AIDS interventions and the 2001 WTO Doha Declaration on TRIPS and Public Health [25]. Rather than agreeing to inappropriate intel- lectual property ... sub-Saharan Africa with high HIV/AIDS burdens, as well as India, are heavily reliant on t he availability of Indian-produced generic ARVs to support their national treatment programmes. Trade-related...

Ngày tải lên: 20/06/2014, 08:20

... rate the care as excellent. Rasch analysis in particular can aid the selection of these additional items. Rasch analysis can also further assess the unidimensionality of the scales. Finally, although ... All authors contributed to the interpretation of data and writing of the manuscript. All authors read and approved the final manuscript. Competing interests The authors declare that they have ... implying that they contri- bute equally to the variance of the total score, and can be summed without weighting. Item-total scale correlations for all scales were satisfactory implying that the items...

Ngày tải lên: 20/06/2014, 15:20

... spread, oestrogen receptor status and histological subtype for all invasive carcinomas. These are factors that are also easily assessed by morphological assessment. Donnellan et al. concluded that ... lobular carcinomas but not in invasive ductal carcinomas. Another study evaluated the bio-molecular differences between ductal and lobular carcinomas in 190 in ductal and 67 lobular carcinomas ... the 9 lymph node metastases is: Low:2, negative:7. Statistical analysis The average age of patients with distant metastases (44 years) was 10 years younger than patients without distant m etastases...

Ngày tải lên: 09/08/2014, 01:24

Ngày tải lên: 11/08/2014, 05:21

Ngày tải lên: 11/08/2014, 16:20

Ngày tải lên: 12/08/2014, 18:20

Ngày tải lên: 12/08/2014, 18:20

Ngày tải lên: 12/08/2014, 22:22