is a way to measure the rate of motion

... biological pathways and thera- peutic approaches [7]. Thus research tactics and strategies may become very similar across diseases [7,8]. In this way, by integrating the mechanisms that govern the ... clinically as ascites, portosystemic encephalopathy and variceal hemorrhage, and often leads to death [4]. Nowadays, a fundamental objective of both experimental and clinical research is the knowledge ... return to the prominence of oxidative metabolism, and thus ang- iogenesis, in the affected epithelial organs to create the capillary bed that would make regeneration of the special- ized epithelial

Ngày tải lên: 13/08/2014, 16:21

... Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... spondylitis and reactive arthritis. A patient with features of more than one rheumatic disease (e.g. OA and crystal-induced arthritis) was classified as having the disease that clinically predominated ... activity allows, in the case of proteases, one to specifically account for the presence of enzymatic inhibitors in SF. This is a key issue as the degrada- tion of the tissue architecture and disease

Ngày tải lên: 09/08/2014, 08:22

... for the item analysis In item analysis the selected statements were administered to 40 farmers in non-sample area of Navalgund taluk in Dharwad district of Karnataka state during 2018-2019 Finally ... enabled farm advisory services were administered to 40 respondents from non sample area of Navalgund taluk of Dharwad district of Karnataka state during 2018-2019 The respondents were asked to ... Identification of specimen, pest and disease is easy because of pictorial representation Language used in the device is simple and clear Always an interpreter is needed to decipher the information The

Ngày tải lên: 20/09/2020, 19:50

... limitations of linkage analysis in complex human diseases has seen a shift in emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based ... asthma medication is currently worth US$5.5 billion a year to the pharmaceutical industry [4]. Asthma is a genetically complex disease that is associated with the familial syndrome of atopy and ... I, Deichmann KA, Izuhara I, Mao I, Adra CN, Hopkin JM: Atopy and asthma: genetic variants of IL-4 and IL-13 sig- nalling. Immunol Today 2000, 21:60–64. 105.Takabayashi A, Ihara K, Sasaki Y, Suzuki

Ngày tải lên: 12/08/2014, 18:20

... gccactccccagtccgccc-3'). The primers used to detect the ampicillin resistant gene are AmpF (5'-gataacactgcg- gccaactt-3') and AmpR (5'-ttgccgggaagctagagtaa-3'). The reactions were ... sample, allow- ing a valid, direct comparison of the growth curves. To obtain a more precise estimate, an idealised mathemat- ical formula was used. An idealised formula relating the initial proportion ... this case, the average number of cells represented is 125 (the average of 156.8, 113.4 and 105). Table 2: An example of the data used to estimate the proportion of cells that were resistant to

Ngày tải lên: 13/08/2014, 09:20

... scenario), the transmission rate is assumed to be constant b over time. In the presence of early intervention, the transmission rate is reduced by a factor a (0 ≤ a ≤ 1) over time interval 0 to ... the average number of secondary cases generated by a single primary case at calendar time t) and g is the rate of recovery. Given time-dependent transmission rate b (t) and susceptible population ... period. Adults also take vacation over a part of this perio d. In addition to strategic school closure as an early countermeasure against influenza [14,15], school holiday is known to suppress the

Ngày tải lên: 13/08/2014, 16:20

... element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proc Natl Acad Sci U S A 97, 1140311408. Kawakami, K., Takeda, H., Kawakami, N., Kobayashi, ... in the major pathway of beta-cell formation in the pancreas. Development 127, 5533-5540. Sawa, C., Yoshikawa, T., Matsuda-Suzuki, F., Delehouzee, S., Goto, M., Watanabe, H., Sawada, J., Kataoka, ... endothelial cells invade in the STM as the hepatoblasts and eventually form the vascular structure in the nascent liver (Matsumoto et al., 2001) The hepatoblasts remain in a

Ngày tải lên: 11/09/2015, 16:06

... subsurface layer are occupied by carbon atoms. VI Calculations indicate that boron atoms preferentially bind at the step sites and at octahedral sites just below the surface. Boron and carbon atoms ... atoms. Step sites are the preferred adsorption sites for carbon atoms and can act as nucleation sites for the formation of graphene islands. On-surface carbon atoms are relatively unstable with binding ... effect of carbon and boron on the activity of a Ni catalyst”, accepted 7. Kong Fei Tan, Jing Xu, Armando Borgna, Mark Saeys, “First principles based design of a Fisher-Tropsch synthesis catalyst

Ngày tải lên: 11/09/2015, 16:06

... that was proposed in the homogeneous literature. The only difference here is that the availability and participation of other surface metal atoms that can assist the reaction on the surface. The ... of the metal surface and affect the kinetics of methane activation. (b) Oxygen-assisted dissociative adsorption In this mechanism, the chemisorbed oxygen atoms participate actively and abstract ... classical, non-assisted reductive elimination step A metal atom is inserted in a methane C-H-bond to form a hydrogen atom and a methyl species. This mechanism is identical to the mechanism on a clean

Ngày tải lên: 11/09/2015, 16:06

... therapeutics: molecular mechanisms and opportunities Antioxid Redox Signal 11, 3013-3069 72 Yamamoto, T., Sakaguchi, N., Hachiya, M., Nakayama, F., Yamakawa, M., and Akashi, M (2009) Role of catalase in monocytic ... 123-132 37 Komatsu, D., Kato, M., Nakayama, J., Miyagawa, S., and Kamata, T (2008) NADPH oxidase plays a critical mediating role in oncogenic Ras-induced vascular endothelial growth factor expression ... like to express my sincere appreciation to all members of the ROS ,apoptosis and cancer biology lab for accommodating me as a ‘surrogate/adpoted’ member of their lab In this ½ years I have not

Ngày tải lên: 26/09/2015, 10:44

... SNR is a random variable, the average SNR is used as the measure. Another standard measure in fading channels is the outage probability, which is the probability that the instantaneous error rate ... of Joint UWBST and IWUWBS 2004, May 2004 5 [3] S Niranjayan, A Nallanathan and B Kannan, A New Analytical... standardization Different performance measures are available to evaluate ... in parameter estimation, which in turn will have a direct impact on the data rate of the feedback path. In order to reduce the computation load at the receiver and the feedback data rate, adaptive channel

Ngày tải lên: 05/10/2015, 22:04

... five Lebanese prisoners The deal could pave the way for Israel to the same with Hamas, the Islamist movement that controls Gaza See article The usual suspect Anwar Ibrahim, leader of the opposition ... various victories Then last year his name was linked to bizarre allegations, by the son of a former Pakistani president, against an unnamed brigadier who had once sold Indian war plans to Pakistan ... Malaysia, briefly took refuge in the Turkish embassy in Kuala Lumpur He said he feared for his safety after a young male volunteer to his political campaign accused him of sexual assault Mr Anwar

Ngày tải lên: 30/03/2017, 14:17

... evaluation of the performance We conducted a survey of 66 manufacturing companies in Australia The size of the organization is measured by the team through three measures: Total sales, Total assets, ... observation variable Afterwards, the authors assesses the reliability of the scale and Analyze the EFA Discovery Factor to examine the convergence of the observed variables Based on the research ... map adds a second layer of detailed information that illustrates the dynamics of a strategy at time- based; strategy map provides a consistent way to describe strategies, so that measures and objectives

Ngày tải lên: 16/01/2020, 17:32

... child’s reaction to medical tasks or the emphasis of the disease during the interaction However, disease-specific observational rating scales are still not available The aim of this study is therefore ... reflected in the observed behaviors In contrast, applying rating scales has the advantage that affective components can be taken into account This way of coding observational data allows making many dimensions ... situation (playing with clay or making a puzzle) one of the parents and their child were asked to play together as they normally would (this parent was also the focus of the parent– child interaction

Ngày tải lên: 02/03/2020, 15:54

... the zakat supply chain Caturida Meiwanto Doktoralinaa*, Zakaria Baharib, Shahir Akram Hassanb, Nor Asmat Ismailc and Sri Ayu Lailatul Mardiyahd a Faculty of Business and Economics, Universitas ... (2017) Analisis Framing Pemberitaan Dahlan Iskan Dalam Kasus Dugaan Korupsi Gardu Induk Listrik Di Koran Jawa Pos Edisi Bulan Juni-Agustus 2015 Universitas Muhammadiyah Surakarta Sheldon, P., Rauschnabel, ... Zakat hashtags play a major role in increasing Zakat awareness, represent a significant contribution to increasing awareness of Zakat payments among the general public Zakat awareness and marketing

Ngày tải lên: 26/05/2020, 22:57

... into the injector of the gas chromatograph for analysis of the adsorbed reaction products Volatiles were analyzed on a Shimadzu 1 7A gas chromatograph coupled to a Shimadzu (http://www.shimadzu.com) ... phenomenon is epistasis, namely the function of these sites can only be manifested with the changes of additional amino acids in the appropriate context [18] Further systemic creation and analysis of additional ... Hierarchical clustering analysis was performed in MATLAB using the clustergram function in the bioinformatics toolbox The Mahalanobis Distance was used to calculate the distance matrix, from which the

Ngày tải lên: 27/05/2020, 01:14

... microorganisms (fecal coliform) which aim to protect the water quality and aquatic ecosystems The results showed the treatment effectiveness of loading of 500mL/min/m2 is higher than the loading of ... especially in the reed planting trial In particular, the treatment efficiency of pollutants such as TSS, BOD 5, COD reached a high rate of 85%, 90%, and 87%, respectively In addition, ANOVA statistical ... Abstract: The study aims to assess the applying effectiveness of constructed wetland technology for polluted surface water treatment The experimental models were operated with hydraulic loadings of

Ngày tải lên: 25/09/2020, 11:22

... firms have the help of sophisticated information systems and data warehouses been able to manage a great deal of data. The challenge is to capture and measure soft and qualitative information. ... the fact that these indicators are much easier to measure. In addition, conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is ... customer retention and other parameters related to the customer, whereas the role of the employees, their satisfaction, loyalty and the link between these variables and profitability is not often...

Ngày tải lên: 20/12/2013, 17:15

... knowledge and awareness of the available brand. • Alternative evaluation: this is the stage whereby the consumers evaluate and rank alternative brand based on the information they have. Such information ... but attaining this objective is not always an easy task due to the fact that the products and services of many fast food restaurants are similar and their means of distributions are alike. ... of the restaurant is good, the drive sound system was clear and well dressed neat and trained staffs”. Therefore MacDonald can be said to have a larger degree of dispersion of data around the...

Ngày tải lên: 24/09/2012, 17:19

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting PCR prod- ucts, containing ... We then inserted the leader mRNA from the L. lactis ald gene as follows. A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ ... pattern. By coregulating PK and LDH cells can maintain homolactic fermenta- tion. The fact that the effects of PK and LDH almost cancel each other out may also add to the explanation of why the...

Ngày tải lên: 19/02/2014, 17:20