def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

... def (digestive- organ expansion factor) IS A CRUCIAL GENE FOR THE DEVELOPMENT OF ENDODERM- DERIVED ORGANS IN ZEBRAFISH (Danio rerio) RUAN HUA (M.Sc., Wuhan University, P.R.China) A THESIS SUBMITTED ... before reviewing zebrafish intestine, liver and pancreas organogenesis 1.3.1 Endoderm formation in zebrafish 1.3.1.1 Endoderm formation and endoderm marker genes Fate mapping studies in zebrafish ... organogenesis 1.3.4 Pancreas morphogenesis in zebrafish 1.3.4.1 Exocrine and endocrine pancreas in zebrafish Like the mammalian pancreas, zebrafish pancreas is also composed of two tissues, endocrine pancreas...

Báo cáo Y học: Arginine 121 is a crucial residue for the speciﬁc cytotoxic activity of the ribotoxin a-sarcin potx

... His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-speciﬁcity ... However, Table Activity of a- sarcin and its mutant variants against ApA at pH 5.0 Kinetic parameters (^ SD) determined from the transesteriﬁcation of ApA by linear regression analysis of double ... using the dinucleotide ApA as substrate [18] Both mutant variants hydrolysed ApA They displayed a Km value similar to that of the wild-type protein although they exhibited a lower catalytic efﬁciency...

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... reactivating factors – that is, subunit swapping might occur However, no biochemical evidence for this has been obtained so far A similar reactivating factor for ethanolamine ammonia lyase has been ... responsible for the reactivation of the inactivated holoenzymes of DD [1 5–1 7] and glycerol dehydratase [1 8–2 0] were found, and designated DD-reactivating factor and glycerol dehydratasereactivating factor, ... we have to await the structural analysis of a real enzyme reactivase complex A B Experimental procedures Fig Subunit swapping between DD and the reactivase (DD-R) (A) and the existence of a cavity...

HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

... therefore appears to induce stem cell transmigration across an endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant ... migration It is suggested that glioma modulated ECM may act as a local guidance for NSC homing in addition to other growth factors or signaling pathways [72] Glioma- produced ECM can play an important ... imaging, NSCs migrated along HGF gradient We conclude that HGF is a major chemoattractant in NSC homing to glioma VIII List of Tables Table List of pre-clinical trials that make use of NSCs as...

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding afﬁnity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine whether the nucleolin identiﬁed ... This revealed a band at approximately 95 kDa present in the PTPr eluate only These data conﬁrm that nucleolin is a binding partner for PTPr under these conditions PTPr can bind directly to nucleolin...

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire is diverse and the optimal antigen target ... Cite this article as: d’Hennezel et al.: IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and ... cells found in the blood, whether it be in their repertoire, function and state of activation, may not accurately reflect the status and behavior of their counterparts localized in the target...

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

... obesity and chronic diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... which healthy dietary habits and physical activity have for reducing the risk for chronic diseases amongst decision makers, health professionals, the media and the public at large? – Which are the...

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

... Annals of Mathematics, 167 (2008), 701–766 A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius Abstract In [KSb] we studied the following model for the spread ... movement of all the other particles In the present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason ... to the type of one of their neighbors SHAPE THEOREM FOR SPREAD OF AN INFECTION 703 according to appropriate rules One starts with all cells oﬀ the origin of type A and a cell of type B at the...

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

... faculty of growing either as parasites or saprophytes, in which case they are known as facultative parasites or saprophytes The great majority of bacteria of interest in dairying belong to the ... together with a limited amount of mineral matter The nitrogen and carbon are most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as ... differentiated, and that is, that practically all of them are capable of producing their characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere...

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management. ") ... selection of education, marketing, and law as sets of tools that can be brought to bear on the management of public health and social issue behaviors The article continues with a consideration of the ... Public Health and Social Issue Behavior Management Because many managers are not trained formally in marketing, they often tend to neglect key issues that are important in the use of a marketing...

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... Effects of hypoxia on HO-1 and HO-2 expression in human cell lines We initially analyzed the effects of hypoxia on the expression of HO-1 and HO-2 in human cell lines of Reduced expression of heme oxygenase-2 ... we have analyzed the effect of hypoxia on the expression levels of HO-1 and HO-2 in various types of human cell line, including erythroleukemia and hepatoma cells We have shown that hypoxia reduces ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Oxidative damage to mitochondrial DNA is increased in Alzheimer’s disease Ann Neurol 36, 747–751 Modulation of metal availability for treating AD 81 Maynard CJ, Cappai R, Volitakis I, Cherny RA,...

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ... Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L-gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L-gulono-1,4-lactone oxidase...

Báo cáo "A new formulation for fast calculation of far field force in molecular dynamics simulations " ppt

... the performance of FMM on GRAPE In this paper we describe our new formulation to speed up far field force calculation – a significant calculation part of FMM on GRAPE Remaining parts of the paper ... and force evaluation Force- evaluation stage consists of near field and far field evaluation parts In the case of original FMM, only the near field part of the force- evaluation stage can be performed ... have newly developed a conversion procudure (hereafter A2P conversion) presented in section 3 A new formulation for fast calculation of far field force Eq (3) gives solution for outer expansion of...

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae ... glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium that has the most ancient ... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae...

Xem thêm

Từ khóa: a common base for the development of coronary heart disease diabetes arthritis mental health neurodegenerative diseases and cancer a promising tool for the development of electrochemical cells a experimental evidence for the requirement of vm and ha in retroviral cross species transmission is a way to measure the rate of motion v— is the percentage of dca in serum a valid marker for the percentage of dca in bile matrices u and v included here eigenvectors of a t a a a or t s a is a diagonal matrix with the roots of the eigenvalues of a t also called singular values spawning stock biomass is a suitable proxy for the reproductive potential of a stock example it is a common misconception that the amount of explosive itself is the chief contributor to the amount of odor available to a canine in fact odor availability depends not only on the amount of explosive material but also the explosi a simplified method for the determination of bulldozing resistance a shell system for the generation of clinical documents 2 specifying a time delay for the application of archived redo log files use a defined constant for the size of an array cumulative specificity a universal mechanism for the initiation of protein synthesis a mutagenesis approach for the study of the structure function relationship of human immunodefic neuronal insulin receptor signaling a potential target for the treatment of cognitive and mood Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ