def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

... def (digestive- organ expansion factor) IS A CRUCIAL GENE FOR THE DEVELOPMENT OF ENDODERM- DERIVED ORGANS IN ZEBRAFISH (Danio rerio) RUAN HUA (M.Sc., Wuhan University, P.R.China) A THESIS SUBMITTED ... before reviewing zebrafish intestine, liver and pancreas organogenesis 1.3.1 Endoderm formation in zebrafish 1.3.1.1 Endoderm formation and...

Ngày tải lên: 11/09/2015, 16:06

199 297 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

... His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity ... However, Table Activity of a- sarcin and its mutant variants against ApA at pH 5.0 Kinetic parameters (^ SD) determined from the transesterification of ApA by linear...

Ngày tải lên: 31/03/2014, 23:20

7 435 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... reactivating factors – that is, subunit swapping might occur However, no biochemical evidence for this has been obtained so far A similar reactivating factor for ethanolamine ammonia lyase has been ... responsible for the reactivation of the inactivated holoenzymes of DD [1 5–1 7] and glycerol dehydratase [1 8–2 0] were found, and designated DD-reactivating fac...

Ngày tải lên: 15/02/2014, 01:20

13 621 0
HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

... therefore appears to induce stem cell transmigration across an endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant ... migration It is suggested that glioma modulated ECM may act as a local guidance for NSC homing in addition to other growth factors or signaling pathways [72] Glioma- pro...

Ngày tải lên: 09/09/2015, 08:17

128 211 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine wh...

Ngày tải lên: 19/02/2014, 05:20

14 670 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire is diverse and the optimal antigen target ... Cite this article as: d’Hennezel et al.: IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in org...

Ngày tải lên: 18/06/2014, 16:20

12 574 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

... obesity and chronic diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings togeth...

Ngày tải lên: 14/02/2014, 13:20

22 704 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

... Annals of Mathematics, 167 (2008), 701–766 A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius Abstract In [KSb] we studied the following model for the spread ... movement of all the other particles In the present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths...

Ngày tải lên: 16/02/2014, 06:20

67 490 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

... faculty of growing either as parasites or saprophytes, in which case they are known as facultative parasites or saprophytes The great majority of bacteria of interest in dairying belong to the ... together with a limited amount of mineral matter The nitrogen and carbon are most available in the form of organic compounds, such as albuminous material Carbon in the...

Ngày tải lên: 16/02/2014, 22:20

201 541 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management. ") ... selection of education, marketing, and law as sets of tools that can be brought to bear on the management of public health and social...

Ngày tải lên: 18/02/2014, 02:20

14 780 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... Effects of hypoxia on HO-1 and HO-2 expression in human cell lines We initially analyzed the effects of hypoxia on the expression of HO-1 and HO-2 in human cell lines of Reduced expression of heme oxygenase-2 ... we have analyzed the effect of hypoxia on the expression levels of HO-1 and HO-2 in various types of human cell li...

Ngày tải lên: 19/02/2014, 06:20

12 622 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is...

Ngày tải lên: 07/03/2014, 10:20

9 634 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo "A new formulation for fast calculation of far field force in molecular dynamics simulations " ppt

Báo cáo "A new formulation for fast calculation of far field force in molecular dynamics simulations " ppt

... the performance of FMM on GRAPE In this paper we describe our new formulation to speed up far field force calculation – a significant calculation part of FMM on GRAPE Remaining parts of the paper ... and force evaluation Force- evaluation stage consists of near field and far field evaluation parts In the case of original FMM, only the near field part of...

Ngày tải lên: 22/03/2014, 11:20

8 430 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae ... glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium th...

Ngày tải lên: 23/03/2014, 15:21

11 503 0
w