Quantification of spheroid formation mechanism by size and shape analysis
... spheroids 48 1.3 Effect of processes on size and size distribution of spheroids 49 1.4 Shape of size distribution between ES and RP spheroids 56 1.5 Effect of processes on spheroid ... Mean size and size distribution of ESC(TS) spheroids derived from size analysis using sieves .76 Table 10 Mean size and size distribution of ESC(TS) spheroids derived...
Ngày tải lên: 11/09/2015, 16:05
... glucose and two aldehydes (MG and GA) in inducing lipid and protein oxidation and antioxidant depletion of LDL particles as well as glycation of the apoB protein by measuring specific parameters of ... course, and extent of the covalent and oxidative changes that occur on LDL particles exposed to glucose, GA, and MG have been quantified in order to determine t...
Ngày tải lên: 31/03/2014, 01:20
... for studying rafts is interrupting rafts by changing the amount of cholesterol in cells, which includes increasing its amount by adding in extra cholesterol and extracting it by drug treatments ... thereby enabling the exposure of the ligand-binding pocket of domain L1 and L2 The dimerization arm in domain CR1 is known to facilitate the formation of dimers, which lead...
Ngày tải lên: 10/09/2015, 09:25
The chart below shows the amount of leisure time enjoyed by men and women of different employment status
Ngày tải lên: 04/10/2012, 10:02
Tài liệu Báo cáo khoa học: Plasticity of S2–S4 specificity pockets of executioner caspase-7 revealed by structural and kinetic analysis pdf
... demonstrate the plasticity of substrate recognition by caspase-7, and will be valuable for the design of inhibitors of this pharmacologically important enzyme Results Inhibition of caspase-7 by tetrapeptide ... et al Plasticity of caspase-7 specificity pockets was blocked in the crystal structure of caspase-3 in complex with the inhibitor of apoptosis protein X...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx
... slightly The hepatocytes exhibited similar characteristics Effect of chelators on uptake of NTBI The effects of the chelators on NTBI uptake by hepatocytes and Q7 hepatoma cells were marked and similar ... Characterisation of citrate and iron citrate uptake by cultured rat hepatocytes J Hepatol 29, 603–613 27 Trinder, D & Morgan, E.H (1997) Inhibition of...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: Oxygen-dependent regulation of hypoxia-inducible factors by prolyl and asparaginyl hydroxylation pdf
... mechanism of regulation of both domains involves a common iron dependent process [74,75,79] Regulation of HIFa subunits by oxygen-dependent prolyl and asparaginyl hydroxylation A variety of oxygen ... Moreover, Fig Regulation of hypoxia inducible factors (HIF) by oxygen-dependent hydroxylation In oxygenated conditions (normoxia) the asparaginyl and HIF...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo Y học: Regulation of transcription of the Dnmt1 gene by Sp1 and Sp3 zinc finger proteins doc
... through the same GA motif Sp1 and Sp3 bound to the same cis-element in the promoter of the gene for Dnmt1 Therefore, we next examined whether activation by Sp1 or by Sp3 affect expression of the gene ... stimulated by either pPacSp1 or pPacUSp3 (Fig 4C,D) These results indicate that both Sp1 and Sp3 enhanced transcription from the Dnmt1 promoter...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khoa học: Fluorescence quenching and kinetic studies of conformational changes induced by DNA and cAMP binding to cAMP receptor protein from Escherichia coli ppt
... uorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli Eur J Biochem 270, 14131423 Yu S & Lee JC (2004) Role of residue ... changes induced by DNA and cAMP 19 20 21 22 23 24 25 26 27 28 29 30 31 cAMP -induced allosteric changes in T127I, S128A and T127I S128A mut...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc
... lysed in 100 lL of SDS/PAGE sample buffer by boiling for min, proteins were resolved by means of 7.5% SDS/PAGE and analysed by immunoblotting with monoclonal anti-(P-Tyr) antibody followed by ... Evidence of a laminin binding protein on the surface of Leishmania donovani Biochem Biophys Res Commun 226, 101–106 Ghosh, A., Bandyopadhyay, K., Kole, L & Das, P.K (1999) I...
Ngày tải lên: 08/03/2014, 23:20
synthesis of hematite (r-fe2o3) nanorods diameter-size and shape effects on their
... the concentration of HCHO gas, which is certainly scientifically and technically interesting Conclusions In summary, we have described in this paper the shapecontrolled synthesis of hematite (R-Fe2O3) ... the formation of porous R-Fe2O3 and reminiscent of the orientation-ordered nanostructures for R-Fe2O3 in air conditions based on the combined analysis of DrTGA and...
Ngày tải lên: 20/03/2014, 13:08
Find-A-Ride: A listing of TLC Licensed Bases by Borough and by Zip Code pdf
... OCEAN AVENUE 718-676-0126 Paratransit B90605 ALMAZ TRANSPORTATION INC 2313 AVENUE X 718-769-5600 Paratransit B90537 ALTA MEDICAL TRANSPORTATION, INC 2834 CONEY ISLAND AVENUE 212-202-5555 Paratransit ... FIRST CLASS C/L SVC CORP 4980 BROADWAY NEW YORK, NY Last updated Thursday, February 07, 2013 Page of 70 Manhattan Name of Base Street Address Telephone Base Type License # SEAMAN RADIO DIS...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... of polyneuridine aldehyde into epi-vellosimine This central reaction of the pathway is catalysed by the enzyme polyneuridine aldehyde esterase (PNAE) The...
Ngày tải lên: 24/03/2014, 04:21
báo cáo hóa học:" Quality of Life as reported by children and parents: a comparison between students and child psychiatric outpatients" ppt
... to several life domains [32] This concept is partly comprised of positive and negative affect as an emotional appraisal of health and life circumstances, as well as an emotional state that is determined ... J Am Acad Child Adolesc Psychiatry 2008, 47(3):317-327 doi:10.1186/1477-7525-8-136 Cite this article as: Jozefiak et al.: Quality of Life as reported by c...
Ngày tải lên: 20/06/2014, 15:20