Structural analysis of calcium induced changes in gelsolin and adseverin

Structural analysis of calcium induced changes in gelsolin and adseverin

Structural analysis of calcium induced changes in gelsolin and adseverin

... disassembly Gelsolin/ villin superfamily severs actin filaments Twinfilin inhibits actin nucleotide exchange Actin/Bundling/Crosslinking Proteins α-actinin connects and organizes actin filaments EPLIN ... N-terminal half of gelsolin During apoptosis, caspase-3 cleaves gelsolin between domains and 4, yielding a calcium- independent, threedomain, actin-severing protein (Kothakota et...

Ngày tải lên: 11/09/2015, 10:17

159 273 0
Báo cáo khoa học: Structural analysis of lipopolysaccharides from Haemophilus influenzae serotype f Structural diversity observed in three strains ppt

Báo cáo khoa học: Structural analysis of lipopolysaccharides from Haemophilus influenzae serotype f Structural diversity observed in three strains ppt

... the diversity within the type f cluster Previous studies of LPS from H in uenzae have resulted in a structural model consisting of a conserved Ó FEBS 2003 Structural diversity of LPS in H in uenzae ... structural details for the LPS from H in uenzae type f strains Previous analyses on LPS from H in uenzae strains expressing a capsule have been lim...

Ngày tải lên: 23/03/2014, 21:20

15 374 0
Báo cáo hóa học: " Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early-stage breast cancer" pot

Báo cáo hóa học: " Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early-stage breast cancer" pot

... question of detecting therapy-related changes in the mass profiles registered for blood samples collected from breast cancer patients SELDI-ToF analysis of the plasma proteome of breast cancer patients ... Pietrowska et al., Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with earlystage br...

Ngày tải lên: 18/06/2014, 16:20

11 391 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...

Ngày tải lên: 12/08/2014, 03:20

25 292 0
báo cáo khoa học: " Evaluation of protein pattern changes in roots and leaves of Zea mays plants in response to nitrate availability by two-dimensional gel electrophoresis analysis" pdf

báo cáo khoa học: " Evaluation of protein pattern changes in roots and leaves of Zea mays plants in response to nitrate availability by two-dimensional gel electrophoresis analysis" pdf

... content of total proteins, amino acids, reducing sugars and sucrose in roots (A, C, E and G) and leaves (B, D, F, and H) and chlorophyll content in leaves (I) of Zea mays plants, previously grown in ... induced by nitrate in both roots and leaves of Zea mays plants The attention was focused on the changes in the pattern of protein s...

Ngày tải lên: 12/08/2014, 03:21

17 325 0
Báo cáo y học: "Further cautions for the use of ventilatory-induced changes in arterial pressures to predict volume" docx

Báo cáo y học: "Further cautions for the use of ventilatory-induced changes in arterial pressures to predict volume" docx

... very large swings in arterial pressures, but these swings should be minimally responsive to volume infusion because they are minimally related to right heart filling Based on the above analysis, ... this cause of PPV is not volume responsive These studies further emphasize the limited usefulness of ventilatory-induced changes in arterial pressure for predicting volum...

Ngày tải lên: 13/08/2014, 21:21

2 220 0
A discourse analysis of economic export contracts in english and vietnamese

A discourse analysis of economic export contracts in english and vietnamese

... foreigners and Vietnamese people in the course of making economic export contracts by an analysis of economic export contracts in English and Vietnamese With the examples of economic export contracts in ... ii MINISTRY OF EDUCATION AND TRAINING UNIVERSITY OF DANANG PHAM THI NGUYET THO A DISCOURSE ANALYSIS OF ECONOMIC EXPORT CONTRACT...

Ngày tải lên: 26/11/2013, 13:26

101 798 6
A discourse analysis of collective labour agreements in english and vietnamese

A discourse analysis of collective labour agreements in english and vietnamese

... ECAs and from 25 to 30 ones in VCAs were chosen 3.4 DATA COLLECTION 3.5 DATA ANALYSIS One hundred official collective agreements are collected for - Analyzing data: ECAs and VCAs are analyzed in ... some implications for teaching and learning as the analysis consisting of fifty samples in English and fifty in Vietnamese well as producing collective agreements...

Ngày tải lên: 26/11/2013, 13:30

13 605 0
a contrastive analysis of idioms denoting fear in english and vietnamese = phân tích đối chiếu các thành ngữ chỉ nỗi sợ hãi trong tiếng anh và tiếng việt

a contrastive analysis of idioms denoting fear in english and vietnamese = phân tích đối chiếu các thành ngữ chỉ nỗi sợ hãi trong tiếng anh và tiếng việt

... features of idioms denoting Fear Based on reliably collected data, both English and Vietnamese idioms contain a great number of patterns denoting fear As a matter of fact, two different languages ... of inability to stand on one‟s feet, inability to move, inability to breath, increase in heart rate, lapse in heartbeat, and inability to speak The unusual cha...

Ngày tải lên: 02/03/2015, 14:17

52 1,5K 4
a contrastive analysis of noun-verb conversion in english and vietnamese = phân tích đối chiếu chuyển loại danh từ sang động từ trong tiếng anh và tiếng việt

a contrastive analysis of noun-verb conversion in english and vietnamese = phân tích đối chiếu chuyển loại danh từ sang động từ trong tiếng anh và tiếng việt

... conversion in terms of grammatical and semantic features in implicating for EFL teaching and learning In this chapter, the contrastive analysis of N-V in English and Vietnamese is carried out N-V conversion ... verbs in English and Vietnamese  Chapter 2: This chapter offers a detailed contrastive analysis of N-V conversion in English and...

Ngày tải lên: 02/03/2015, 14:18

46 1,5K 10
An analysis of cohesive devices used in pride and prejudice by jane austen in comparison with its vietnamese translation

An analysis of cohesive devices used in pride and prejudice by jane austen in comparison with its vietnamese translation

... MINISTRY OF EDUCATION AND TRAINING HANOI OPEN UNIVERSITY TA MINH HANG AN ANALYSIS OF COHESIVE DEVICES USED IN PRIDE AND PREJUDICE BY JANE AUSTEN IN COMPARISON WITH ITS VIETNAMESE TRANSLATION ... 26 CHAPTER AN ANALYSIS OF COHESIVE DEVICES USED IN PRIDE AND PREJUDICE BY JANE AUSTEN IN COMPARISON WITH ITS VIETNAMESE TRANS...

Ngày tải lên: 17/07/2015, 11:06

82 1,3K 6
Indication of density dependent changes in growth and maturity of the barndoor skate on georges bank

Indication of density dependent changes in growth and maturity of the barndoor skate on georges bank

... 10.1080/19425120.2013.824941 ARTICLE Indication of Density- Dependent Changes in Growth and Maturity of the Barndoor Skate on Georges Bank Karson Coutr´ * e Marine Science Center, University of New England, 11 Hills Beach ... using the index of 263 GROWTH AND MATURITY OF BARNDOOR SKATE SEXUAL MATURITY Females.—Sexual maturity in females w...

Ngày tải lên: 04/09/2015, 12:38

11 448 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

... recently GIS and remote sensing has been using in several types of works in both government and private agencies As we know, GIS and remote sensing have an important role in linkage and analysis of ... data, in particular for detection, interpretation, area calculation, monitoring and future estimating Therefore, this study applied GIS and remote...

Ngày tải lên: 17/03/2014, 11:20

24 897 0
Molecular analysis of maternal diabetes induced changes in the developing neural tube

Molecular analysis of maternal diabetes induced changes in the developing neural tube

... in e A III LV E B dc dc e vtw vtw E C vt dt D Fig Thickness of Ventral Telencephalon Wall (µm) 300 250 * 200 150 100 50 Fig Control Diabetic vt dt vt vt A B Fig % of BrdU-cells in Ventral ... vt B e A Fold of induction 3.5 ** 2.5 1.5 0.5 Control Diabetic B 333bp C Fig dc dc III vt A vt B LV A Fig dc e dc III vt vt LV A Fig dt B III e e e dc vt LV A Fig 10 B A Fold of induction 1.5...

Ngày tải lên: 26/11/2015, 12:46

19 180 0
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

... compare the safety and efficacy of three bone health Plans using three independent sequentially enrolled groups of healthy women 40 years of age and older The primary outcome measure was changes in ... reviewed in the meta-analysis cited above As for the unusual finding of the increased BMD levels found in the three study groups, the superiority...

Ngày tải lên: 25/10/2012, 11:10

12 664 0
w