Lactobacillus as a vaccine vehicle for therapy
... Disadvandages of using attenuated pathogenic bacteria as vaccines 11 1.2.3 Commensal microorganisms as vaccine vehicles 13 1.3 Lactic Acid Bacteria as vaccine vehicles 13 1.3.1 Lactococcus lactis ... candidates for vaccination Lactobacillus plantarum, 16 Lactobacillus casei, Lactobacillus helveticus, Lactobacillus acidophilus, Lactobacillus reuteri, Lactobacillus brevi...
Ngày tải lên: 11/09/2015, 10:06
... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA...
Ngày tải lên: 09/09/2015, 18:56
... displaying all major immunological determinants as a vaccine candidate for Lassa hemorrhagic fever Virology Journal 2010 7:279 Submit your next manuscript to BioMed Central and take full advantage ... resulting in large areas of monolayer breakdown (Figure 2C) Cellular cytotoxicity was measured by MTT assays, and chromosomal DNA fragmentation analysis was employed to d...
Ngày tải lên: 12/08/2014, 01:22
Development of bordetella pertussis as a live vehicles for heterologous antigens delivery, and its application as a universal influenza a vaccine
... DEVELOPMENT OF BORDETELLA PERTUSSIS AS A LIVE VEHICLE FOR HETEROLOGOUS ANTIGEN DELIVERY, AND ITS APPLICATION AS A UNIVERSAL INFLUENZA A VACCINE LI RUI B.Sc.; M.Sc A THESIS SUBMITTED FOR THE ... is particularly well adapted for the nasal delivery of heterologous vaccines candidates and has already been reported as a promising mucosal vacci...
Ngày tải lên: 11/09/2015, 10:00
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... of a passive planar air breathing fuel cell cathode J Power Sources 2007, 167(1), 118–129 [3] Rajani B.P.M and Kolar A. K A model for a vertical plan...
Ngày tải lên: 05/09/2013, 14:58
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... pretreatment, enzymatic saccharification and fermentation of wheat straw to ethanol Journal of Biobased Materials and Bioenergy 2008, 2(3), 210-217 [68] Saha B.C., Cotta...
Ngày tải lên: 05/09/2013, 15:28
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... Na -palmitoylation of Gas is regulated also remains unclear However, we assume that mammalian Gup1 competes with Skn for Shh to prevent palmitoylation rather than catalyzing...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc
... not affect basal PLD1 activity or PMA-stimulated PLD1 activation, but completely ablated stimulation of PLD1 by H2O2 This shows that PrxII can function as a negative regulator of PLD1 activation ... PLD1 generation of PA H2O2 can participate in many signaling pathways, including both pro-apoptotic and anti-apoptotic ones PrxII is proposed here to function as a signal terminator, el...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " ppt
... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was ... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7...
Ngày tải lên: 21/02/2014, 10:20
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " docx
... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was ... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7...
Ngày tải lên: 21/02/2014, 10:20
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... implies that MYP has a role as a zinc transporter for gametogenesis In vertebrates, vitellogenin, a precursor of yolk protein, is a zinc- bind4994 ing protein that transports the zinc required for oogenesis ... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot
... conformations of these peptides and to analyse the interaction between peptides and the mAb to obtain clear evidence that the peptides are real mimotopes of GAs and to confirm the existence of peptidyl ... GA4 for the mAb So far, quite a number of peptidyl mimics for carbohydrates or double-stranded DNA have been prepared [1–3] Mimicry peptides for water-soluble ligan...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: "DATR AS A LEXICAL COMPONENT FOR PATR" pot
... the lexical information encoded in (1) The question that arises is how to relate DATR and PATR so that the hierarchically structured lexical information in DATR can be made available in PATR-usable ... == LEXICAL == yes abbreviates NOUN: NOUN: == LEXICAL ==yes Pollard, Cad / Sag, Ivan (1987) Information-Based Syntax and Semantics, I: Fundamentals Stanford, Calif.: ... Queries that t...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot
... x-hydroxylate the saturated FAs lauric acid, myristic acid (tetradecanoic acid) , palmitic acid (hexadecanoic acid) and the unsaturated FAs oleic acid [(Z)-octadec-9-enoic acid] and arachidonic acid (all-cis-5,8,11,14-eicosatetraenoic ... Mitochondrial b -oxidation and x -oxidation In the case of mitochondrial FA b -oxidation disorders, there is accumulation of certain FAs e...
Ngày tải lên: 22/03/2014, 16:21