Modifiers of inflammatory angiogenesis in a murine model 3

Modifiers of inflammatory angiogenesis in a murine model 3

Modifiers of inflammatory angiogenesis in a murine model 3

... mice A Corneal angiogenesis at day and day after injury in BALB/c and Rag1KO mice B and C: Quantitative analysis of neovascularization at day after injury The bars show the mean ± SEM of independent ... angiogenesis in the corneal injury model A Corneal neovascularization at day and day after injury in the control and RB6-8C5 treatment groups B and C Quantitative analysis...

Ngày tải lên: 11/09/2015, 10:03

90 240 0
Modifiers of inflammatory angiogenesis in a murine model 1

Modifiers of inflammatory angiogenesis in a murine model 1

... formation 11 III Abnormal wound healing 12 1. 3 Cytokines in angiogenesis and wound healing 1. 3 .1 Chemokines in angiogenesis and wound healing 14 14 ii 1. 3.2 TNF-α: proinflammatory cytokine 18 1. 3.3 ... macrophage inflammatory protein-1alpha (MIP -1 ), macrophage inflammatory protein-2 (MIP-2), and tumor necrosis factor alpha (TNF-α) were viii investigated in the i...

Ngày tải lên: 11/09/2015, 10:03

18 199 0
Modifiers of inflammatory angiogenesis in a murine model 2

Modifiers of inflammatory angiogenesis in a murine model 2

... plasmin by plaminogen activators- urokinase plasminogen activators (uPAs) and tissue plasminogen activators (tPAs) (Conaway et al., 20 01) Plasmin has a broad trypsin-like specificity and degrades ... revascularization, inflammatory cell infiltration, and associated synoviocyte hyperplasia, which produce a pannus of inflammatory vascular tissue This pannus covers and erodes articul...

Ngày tải lên: 11/09/2015, 10:03

73 233 0
Characterization of fetomaternal microchimerism in a murine model 1

Characterization of fetomaternal microchimerism in a murine model 1

... gaggagtttccatcacgaaga gacgtagcctggtgtctcg ccatgtacccagacatccact gagcagcaacatcaccacag cccctcattaagcctcagc ccaagaggtccatggtgttt gaaatccaccaaagctcacg gcggagctcagcaagatg ctaaggccaaccgtgaaaag cacatgaagcagcacgactt ... tggaaccgatcagtgtgagt agaggaagggcgaggaga ctccttctgcagggctttc tcgggctccaaacttctct ctgcggttctgaaaccaaat aagctcaagaaaggaaacatgc ggtgtctgcaagcgagagtt tggcgtggacgactcatac accgcccttggttaaagt...

Ngày tải lên: 09/09/2015, 18:49

183 354 0
Characterization of fetomaternal microchimerism in a murine model 2

Characterization of fetomaternal microchimerism in a murine model 2

... 17. 02 17.86 20 .41 18.83 28 .00 27 .20 21 . 82 22. 14 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 20 .26 28 .00 28 .00 22 .61 20 . 92 21 .20 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 32. 55 28 .00 28 .00 28 .00 26 .86 28 .00 28 .00 ... 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 22 .56 22 .96 28 .00 28 .00 24 .98 28 .00 2...

Ngày tải lên: 09/09/2015, 18:49

15 260 0
The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

... function upstream of the effector caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase- 1, caspase- 4, caspase- 5, caspase- 11 and caspase- 12 ) ... caspase- 1 to an influenza A/ Puerto Rico/8/34 (H1N1) virus infection of RAW264.7 murine macrophages, in vitro To investigate the role of ca...

Ngày tải lên: 13/10/2015, 16:41

190 824 0
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx

Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx

... hematoxylin and eosin stained major organs (Figure 5) Taking all these data into consideration, it appears that combination therapy of AdhTERTHRP/IAA and AdCMVmIL-12 had the best therapeutic effect in ... immunosorbant assay; TUNEL: terminal deoxynecleotidyl transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrog...

Ngày tải lên: 18/06/2014, 19:20

10 696 0
Báo cáo sinh học: " Induction of Th1Immune responses following laser ablation in a murine model of colorectal liver metastase" potx

Báo cáo sinh học: " Induction of Th1Immune responses following laser ablation in a murine model of colorectal liver metastase" potx

... 1: faint staining; 2: small amount or weak staining; 3: moderate staining; 4: abundant or strong staining; 5: Abundant or very strong staining Means for each group were determined using the individual ... immediately following ablation Panels f-l are CD3+ stained tumor sections from LA treated animals collected at day post treatment Panels f and g depict CD3+ staining of a vascular la...

Ngày tải lên: 18/06/2014, 19:20

10 556 0
báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot

báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot

... murine brain: (1) The first part of the experimental study was designed to investigate a potential role of TNF-dependent regulation of intracranial IL-18 expression in a standardized model of ... used as internal control and untreated control animals (n = 10) were analyzed for baseline evaluation of intracerebral cytokine profiles in these mice (2) In the...

Ngày tải lên: 19/06/2014, 22:20

6 436 0
báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx

báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx

... appearance of "mature" amyloid plaques [26,30] These plaques contain fibrillar amyloid peptide and as such can be detected by thioflavine, a reagent that stains proteins in beta sheet conformation ... with oligo A or fAβ Characteristic of fibrillar amyloid plaques in both human AD brain and in mouse models of amyloid accumulation is robust association of activated ast...

Ngày tải lên: 19/06/2014, 22:20

19 483 0
báo cáo hóa học: " Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis" ppt

báo cáo hóa học: " Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis" ppt

... this article as: Virgili et al.: Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis Journal of Neuroinflammation 2011 ... by diazoxide treatment We conclude that oral administration of diazoxide constitutes an appropriate therapeutic approach for treating MS and other de...

Ngày tải lên: 19/06/2014, 22:20

18 422 0
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc

báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc

... hematoxylin and eosin stained major organs (Figure 5) Taking all these data into consideration, it appears that combination therapy of AdhTERTHRP/IAA and AdCMVmIL-12 had the best therapeutic effect in ... immunosorbant assay; TUNEL: terminal deoxynecleotidyl transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrog...

Ngày tải lên: 20/06/2014, 03:20

10 485 0
báo cáo hóa học:" Induction of Th1Immune responses following laser ablation in a murine model of colorectal liver metastases" pot

báo cáo hóa học:" Induction of Th1Immune responses following laser ablation in a murine model of colorectal liver metastases" pot

... 1: faint staining; 2: small amount or weak staining; 3: moderate staining; 4: abundant or strong staining; 5: Abundant or very strong staining Means for each group were determined using the individual ... When applied as a minimally invasive technique, thermal ablation has a number of potential advantages including significantly lower morbidity, minimal destruction of normal liver...

Ngày tải lên: 20/06/2014, 03:20

10 500 0
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps

Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps

... 5'-GCCTCCAGCATGAAAGTCTC, 3'-TAAAACAGGGTGTCTGGGGA), IL-1β (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 ... DHMEQ inhibits TNF-α-induced nuclear translocation of NF-κB, and does not inhibit phosphorylation and degradation of IκB, or a c-Jun N-terminal kinase (JNK) and a caspase...

Ngày tải lên: 09/08/2014, 07:20

12 460 0
Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt

Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt

... to a number of factors, including the longevity of the injected protein and the level of free G-actin in the circulation at sites of inflammation inhibiting the DNase I activity Our data obtained ... increase the affinity of the DNase I for DNA, resulting in two improved characteristics – increased specific activity compared to the wild-type enzyme a...

Ngày tải lên: 09/08/2014, 07:20

11 558 0
w