Characterization of fetomaternal microchimerism in a murine model 1

CHARACTERIZATION OF FETOMATERNAL MICROCHIMERISM IN A MURINE MODEL YEO AILING B.Sc (Hons), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NUS GRADUATE SCHOOL FOR INTEGRATIVE SCIENCES AND ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2012 ACKNOWLEDGEMENTS Firstly, I would like to express my deepest gratitude to my former PhD supervisor, Dr Gerald Udolph for his kind advice, mentorship and the opportunity to work under him Secondly, I would like to express my utmost gratitude to my current PhD supervisor, Dr Jerry Chan, for his willingness to mentor the last few months of my PhD candidature I am grateful for all the help that I have received from him I would also like to express my appreciation to Dr Simon Tan, for his infinite patience and guidance provided even after he had left the lab I am truly appreciative of all the time and efforts that he has given to this project, I would like to express my utmost graditute to the Executive Director of Institute of Medical Biology (IMB), Prof Birgitte Lane and Senior Principle Investigators (PI), Prof Barbara Knowles and Prof Davor Solter for providing me with temporary lab space and facilities Without them, I would not have been able to acquire the data necessary to complete my thesis I would like to thank the fellow lab colleagues from Prof Davor Saltor and Prof Barbara Knowles’ lab, especially Dr Lim Chin Yan and Dr Chanchao Lorthongpanich for their kind advice and sharing expertise In addition, I would also like to thank my past and present laboratory colleagues especially Wendy, Wanru and Joanne from Dr Gerald Udolph’s Lab who have been most helpful and have made my stay in the lab an enjoyable one I would like to thank Prof Michael Raghunath and Prof Lim Sai Kiang for agreeing to be part of my Thesis Advisory Committee members Most importantly, I am grateful to the A*Star Graduate Academy for providing this opportunity to study in this field and their generous funding of this project Lastly, not forgetting my family and friends for their constant support throughout my years of PhD studies i TABLE OF CONTENTS ACKNOWLEDGEMENT i TABLE OF CONTENTS ii ABSTRACT iii LIST OF TABLES v LIST OF FIGURES vi ABBREVIATIONS viii CHAPTER 1: INTRODUCTION CHAPTER 2: MATERIAL AND METHODS 19 CHAPTER 3: LONG TERM ENGRAFTMENT OF FETAL CELLS 37 CHAPTER 4: ORGAN-SPECIFIC DIFFERENTIATION OF FETAL CELLS 64 CHAPTER5: FETAL CELLS DERIVED FROM THE EMBRYO PROPER AND THE NEUROECTODERMAL LINEAGE INTEGRATE INTO MATERNAL TISSUES AND ORGANS 75 CHAPTER 6: SINGLE CELL GENE EXPRESSION ANALYSIS OF PERIPHERAL BLOOD FETAL CELLS 104 CHAPTER 7: DISCUSSION 122 CONCLUSION 149 REFERENCES 152 APPENDIX ii ABSTRACT Fetal cells have been shown to transmigrate into the mother through the placental interface during pregnancy and these cells can persist in various maternal organs for as long as decades In animal studies, it has been suggested that fetal cells also termed pregnancy associated progenitor cells (PAPCs) might possess multipotential differentiation capabilities Therefore, fetal cells might have a regenerative function that is potentially useful for cell-based therapies However, much needs to be learned about the basic biology of these fetal cells such as their long-term homing, survival, integration and differentiation in maternal organs and the origin and identity of these fetal cells The persistence of fetal cells in the maternal body led us to hypothesize that these multipotential fetal cells that transmigrate into the maternal body originate from the embryo proper To test the hypothesis, a mouse model, which allows tagging of fetal cells by the reporter, green fluorescent protein (GFP) for in-depth characterization of fetal cells in healthy mothers was used Using various methods such as flow cytometry, qPCR and immunohistochemistry (IHC), a temporal profile of fetal cells trafficking into maternal organs and blood at various pre- and post-natal time points was established Our data demonstrated that fetal cells were able to persist into late adulthood suggesting long-term survival capabilities The organ-specific differentiation capability of fetal cells in two maternal organs was also studied This work showed that fetal cells could differentiate to neurons in the brain and to epithelial and endothelial cell types in the lung iii Next, genetic lineage tagging using the Cre-LoxP recombination technique was done in order to elucidate the developmental origin of fetal cells from the fetus Meox2-cre and Nestin-cre mice were used to lineage tagged embryo proper and neuroectodermal derivatives, respectively The presence of embryo proper-tagged fetal cells suggests an embryo proper origin rather than a trophectodermal origin Neuroectodermally-tagged fetal cells were found in the maternal blood and solid organs such as lung and liver Furthermore, neuroectodermally-tagged fetal cells found in the maternal blood expressed the pan-haemopoietic marker CD45, suggesting that these cells adopted a hematopoietic cell fate These data provided insight into fetal cells originating from the embryo proper and also potentially from the neuroectodermal lineage Lastly, using single cell gene expression analysis, it was found that fetal cells could be grouped according to their gene signatures, which suggests a diverse and mixed population of cell types transfer into mothers during pregnancy with fetal cells with a neuroectodermal signature predominating In addition, changes in the temporal expression profile of some candidate genes such as Oct4 and Runx1 were also observed In conclusion, this study suggests that fetal cells are able to integrate and survive in maternal body long-term and acquire organ-specific cell fates in the lung, blood and brain Fetal cells possibly originate from the embryo proper and in particular from the neuroectodermal lineage Further work should focus on identifying the differentiation capability and origin of fetal cells, which may provide further knowledge, which could allow the translation of these intriguing cells into celltherapy, based clinical applications iv LIST OF TABLES Table 1: List of antibodies used in the study Table 2: Primer sequences for genotyping and gene targets used in the study Table 3: Average number of GFP+ fetal cells in maternal organs during and after pregnancy by QPCR analysis Table 4: Quantification of GFP+ fetal cells in maternal organs after pregnancy by IHC analysis Table 5: List of selected target genes for the Fluidigm expression analysis v LIST OF FIGURES Figure 1: ZGFP-floxed reporter strain expression construct Figure 2: Cre transgenic mouse line expression construct Figure 3: Quantification of GFP+ fetal cells in maternal peripheral blood pre- and post-natally Figure 4: Distribution of GFP+ fetal cells at P0 assayed by qPCR Figure 5: Detection of fetal cells in different maternal organs by confocal microscopy at P0 Figure 6: Long-term engraftment of fetal cells in maternal organs as detected by qPCR Figure 7: Long-term engraftment of fetal cells in maternal organs as detected by IHC Figure 8: Fetal cells were detected in maternal liver at long-term time points Figure 9: Detection of GFP+ fetal cells in maternal kidney by IHC at long-term time Figure 10: Detection of GFP+ fetal cells in maternal intestine by IHC at long-term Figure 11: Detection of GFP+ fetal cells in maternal brain by IHC at long-term time Figure 12: Detection of GFP+ fetal cells in maternal lung by IHC at long-term time Figure 13: Detection of GFP+ fetal cells in maternal heart by IHC at long-term time Figure 14: Ki67 analysis of clusters of GFP+ fetal cells found in P210 Figure 15: Confocal images of brains at P30 mothers with Thy1-YFP+ fetal cells Figure 16: Expression of CD141 on GFP+ fetal cells in maternal lung Figure 17: Temporal analysis of CD31 expression (orange) of fetal cells (green) found in the maternal lung Figure 18: Expression of CK19 (red) on fetal cells (green) in maternal lung vi Figure 19: FACS analysis of PBMCs from positive (MZ+/+ and GFP) and negative (MZ-/- and WT) control animals Figure 20: Presence of GFP+ MZ+/+ fetal cells in maternal peripheral blood as determined by flow cytometry Figure 21: Nestin-cre mediated GFP expression in E14.5 NZ+/+ fetus Figure 22: Histogram of flow cytometry analysis of PBMCs of NZ+/+ pups from Nestin-cre;ZGFP-floxed mating Figure 23: Quantification of GFP+ NZ+/+ fetal cells in maternal blood as determined by flow cytometry analysis Figure 24: Detection of neuroectodermally-tagged GFP+ fetal cells (green) in P30 maternal brain Figure 25: Expression of neuronal marker MAP2 of neuroectodermally tagged GFP+ fetal cells in P30 maternal brain Figure 26: Analysis of CD45 expression in P30 maternal blood Figure 27: Detection of GFP+ NZ+/+ fetal cells in maternal kidney by IHC Figure 28: Detection of GFP+ NZ+/+ fetal cells in the maternal liver by IHC Figure 29: Analysis of CD45 and CK19 expression of GFP+ NZ+/+ fetal cells in maternal lung by IHC Figure 30: Analysis of CD45 expression of actin-GFP+ labelled fetal cells in maternal lung by IHC Figure 32: FACS analysis and sorting of PBMCs Figure 32: Heat map of transcript abundance of 16 genes analysed in 121 cells Figure 33: Frequency of gene expression of fetal cells from maternal circulation Figure 34: Representation of the frequency of fetal cells expressing selected target genes singularly or in combination Figure 35: Number of fetal cells that expressed genes annotated to gene function Figure 36: Boxplot of transcript abundance of the genes that were highly enriched in cells analysed at different gestational time points vii ABBREVIATIONS BM Bone marrow BrdU 5-bromo-2'-deoxyuridine CCl4 Carbon tetrachloride cDNA Complementary DNA CMV Cytomegalovirus DAPI Diamidino-2-phenylindole DNA Deoxyribonucleic acids E Embryonic EPCs Endothelial progenitor cells FACS Fluorescence-activated cell sorting FBS Fetal Bovine Serum FMC Fetomaternal microchimerism GFP Green fluorescent protein GVHD Graft versus host disease HSC Hematopoietic stem cells ICM Inner cell mass IHC Immunohistochemistry IVS Intervillous space LPS Lipopolysaccharies MAP2 Microtubule-associated protein MSC Mesenchymal stem cells NTC Non template control P Postpartum PAPCs Pregnant associated progenitor cells PFA Paraformaldehyde PBMCs Peripheral blood mononuclear cells PBS Phosphate buffered saline PCR Polymerase chain reaction qPCR Quantitative PCR RBC Red blood cell RT Reverse transcription RT-PCR Real-time PCR viii SLE Systemic Lupus erythematosus SP Side population SSc Systemic Sclerosis SSc Sjogrens Syndrome STA Specific target amplification WT Wild type YFP Yellow fluorescent protein ix Galli R, Borello U, Gritti A, Minasi MG, Bjornson C, Coletta M, Mora M, De Angelis MG, Fiocco R, Cossu G, Vescovi AL Skeletal myogenic potential of human and mouse neural stem cells Nat Neurosci 2000;3(10):986-991 Gä nshirt-Ahlert D, Burschyk M, Garritsen HS, Helmer L, Miny P, Horst J, Schneider HP, Holzgreve W Magnetic cell sorting and the transferrin receptor as potential means of prenatal diagnosis from maternal blood Am J Obstet Gynecol 1992;166(5):1350-1355 Gao J, Dennis JE, Muzic RF, Lundberg M, Caplan AI The dynamic in vivo distribution of bone marrow-derived mesenchymal stem cells after infusion Cells Tissues Organs 2001;169(1):12-20 Georgiades P, Ferguson-Smith AC, Burton GJ Comparative developmental anatomy of the murine and human definitive placentae Placenta 2002;23(1):3-19 Gilmore GL, Haq B, Shadduck RK, Jasthy SL, Lister J Fetal-maternal microchimerism in normal parous females and parous female cancer patients Exp Hematol 2008;36(9):1073-1077 Gleiberman AS, Encinas JM, Mignone JL, Michurina T, Rosenfeld MG, Enikolopov G Expression of nestin-green fluorescent protein transgene marks oval cells in the adult liver Dev Dyn 2005;234(2):413-421 Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo J Exp Med 1996;183(4):1797-1806 Gordon MY, Levicar N, Pai M, Bachellier P, Dimarakis I, Al-Allaf F, M'Hamdi H, Thalji T, Welsh JP, Marley SB, Davies J, Dazzi F, Marelli-Berg F, Tait P, Playford R, Jiao L, Jensen S, Nicholls JP, Ayav A, Nohandani M, Farzaneh F, Gaken J, Dodge R, Alison M, Apperley JF, Lechler R, Habib NA Characterization and clinical application of human CD34+ stem/progenitor cell populations mobilized into the blood by granulocyte colony-stimulating factor Stem Cells 2006;24(7):1822-1830 Guetta E, Gutstein-Abo L, Barkai G Trophoblasts isolated from the maternal circulation: in vitro expansion and potential application in non-invasive prenatal diagnosis J Histochem Cytochem 2005;53(3):337-339 Guettier C, Sebagh M, Buard J, Feneux D, Ortin-Serrano M, Gigou M, Tricottet V, Reynè M, Samuel D, Fé C Male cell microchimerism in normal and diseased s ray 159 female livers from fetal life to adulthood Hepatology 2005;42(1):35-43 Guo G, Huss M, Tong GQ, Wang C, Li Sun L, Clarke ND, Robson P Resolution of cell fate decisions revealed by single-cell gene expression analysis from zygote to blastocyst Dev Cell 2010;18(4):675-685 Gussoni E, Soneoka Y, Strickland CD, Buzney EA, Khan MK, Flint AF, Kunkel LM, Mulligan RC Dystrophin expression in the mdx mouse restored by stem cell transplantation Nature 1999;401(6751):390-394 Hamada H, Arinami T, Hamaguchi H, Kubo T Fetal nucleated cells in maternal peripheral blood after delivery Am J Obstet Gynecol 1994;170(4):1188-1193 Hart AH, Hartley L, Sourris K, Stadler ES, Li R, Stanley EG, Tam PPL, Elefanty AG, Robb L Mixl1 is required for axial mesendoderm morphogenesis and patterning in the murine embryo Development 2002;129(15):3597-3608 Hawes CS, Suskin HA, Kalionis B, Mueller UW, Casey G, Hall J, Rudzki Z Detection of paternally inherited mutations for beta-thalassemia in trophoblast isolated from peripheral maternal blood Ann N Y Acad Sci 1994;731:181-185 Herzenberg LA, Bianchi DW, Schrö J, Cann HM, Iverson GM Fetal cells in the der blood of pregnant women: detection and enrichment by fluorescence-activated cell sorting Proc Natl Acad Sci U S A 1979;76(3):1453-1455 Herzog EL, Brody AR, Colby TV, Mason R, Williams MC Knowns and unknowns of the alveolus Proc Am Thorac Soc 2008;5(7):778-782 Hess DA, Craft TP, Wirthlin L, Hohm S, Zhou P, Eades WC, Creer MH, Sands MS, Nolta JA Widespread nonhematopoietic tissue distribution by transplanted human progenitor cells with high aldehyde dehydrogenase activity Stem Cells 2008;26(3):611-620 Holzgreve W, Ghezzi F, Di Naro E, Gä nshirt D, Maymon E, Hahn S Disturbed fetomaternal cell traffic in preeclampsia Obstet Gynecol 1998;91(5 Pt 1):669-672 Hui H, Perfetti R Pancreas duodenum homeobox-1 regulates pancreas development during embryogenesis and islet cell function in adulthood Eur J Endocrinol 2002;146(2):129-141 160 Ichinohe T, Teshima T, Matsuoka KI, Maruya E, Saji H Fetal-maternal microchimerism: impact on hematopoietic stem cell transplantation Curr Opin Immunol 2005;17(5):546-552 Inoue T, Ota M, Ogawa M, Mikoshiba K, Aruga J Zic1 and Zic3 regulate medial forebrain development through expansion of neuronal progenitors J Neurosci 2007;27(20):5461-5473 Jackson KA, Snyder DS, Goodell MA Skeletal muscle fiber-specific green autofluorescence: potential for stem cell engraftment artifacts Stem Cells 2004;22(2):180-187 James E, Chai JG, Dewchand H, Macchiarulo E, Dazzi F, Simpson E Multiparity induces priming to male-specific minor histocompatibility antigen, HY, in mice and humans Blood 2003;102(1):388-393 Jimenez DF, Leapley AC, Lee CI, Ultsch MN, Tarantal AF Fetal CD34+ cells in the maternal circulation and long-term microchimerism in rhesus monkeys (Macaca mulatta) Transplantation 2005;79(2):142-146 Johnson KL, McAlindon TE, Mulcahy E, Bianchi DW Microchimerism in a female patient with systemic lupus erythematosus Arthritis Rheum 2001;44(9):2107-2111 Johnson KL, Samura O, Nelson JL, McDonnell M d WM, Bianchi DW Significant fetal cell microchimerism in a nontransfused woman with hepatitis C: Evidence of long-term survival and expansion Hepatology 2002;36(5):1295-1297 Johnson KL, Stroh H, Tadesse S, Norwitz ER, Richey L, Kallenbach LR, Bianchi DW Fetal Cells in the Murine Maternal Lung Have Well-Defined Characteristics and Are Preferentially Located in Alveolar Septum Stem Cells Dev 2011; Johnson KL, Tao K, Stroh H, Kallenbach L, Peter I, Richey L, Rust D, Bianchi DW Increased fetal cell trafficking in murine lung following complete pregnancy loss from exposure to lipopolysaccharide Fertil Steril 2010;93(5):1718-1721.e2 Jones MJ, Lefebvre L An imprinted GFP insertion reveals long-range epigenetic regulation in embryonic lineages Dev Biol 2009;336(1):42-52 161 Kajstura J, Rota M, Hall SR, Hosoda T, D'Amario D, Sanada F, Zheng H, Ogó B, rek Rondon-Clavo C, Ferreira-Martins J, Matsuda A, Arranto C, Goichberg P, Giordano G, Haley KJ, Bardelli S, Rayatzadeh H, Liu X, Quaini F, Liao R, Leri A, Perrella MA, Loscalzo J, Anversa P Evidence for human lung stem cells N Engl J Med 2011;364(19):1795-1806 Kara RJ, Bolli P, Karakikes I, Matsunaga I, Tripodi J, Tanweer O, Altman P, Shachter NS, Nakano A, Najfeld V, Chaudhry HW Fetal cells traffic to injured maternal myocardium and undergo cardiac differentiation Circ Res 2012;110(1):82-93 Kawada T, Shin WS, Nakatsuru Y, Koizumi T, Sakamoto A, Nakajima T, OkaiMatsuo Y, Nakazawa M, Sato H, Ishikawa T, Toyo-Oka T Precise identification of gene products in hearts after in vivo gene transfection, using Sendai virus-coated proteoliposomes Biochem Biophys Res Commun 1999;259(2):408-413 Kawanami O, Jin E, Ghazizadeh M, Fujiwara M, Jiang L, Nagashima M, Shimizu H, Takemura T, Ohaki Y, Arai S, Gomibuchi M, Takeda K, Yu ZX, Ferrans VJ Heterogeneous distribution of thrombomodulin and von Willebrand factor in endothelial cells in the human pulmonary microvessels Journal of Nihon Medical School = Nihon Ika Daigaku zasshi 2000;67(2):118-125 Kervestin S, Amrani N Translational regulation of gene expression Genome Biol 2004;5(12):359 Khosrotehrani K, Mery L, Aractingi S, Bianchi DW, Johnson KL Absence of fetal cell microchimerism in cutaneous lesions of lupus erythematosus Ann Rheum Dis 2005;64(1):159-160 Khosrotehrani K, Reyes RR, Johnson KL, Freeman RB, Salomon RN, Peter I, Stroh H, Gué S, Bianchi DW Fetal cells participate over time in the response to specific gan types of murine maternal hepatic injury Hum Reprod 2007;22(3):654-661 Khosrotehrani K, Bianchi DW Multi-lineage potential of fetal cells in maternal tissue: a legacy in reverse J Cell Sci 2005;118(Pt 8):1559-1563 Khosrotehrani K, Johnson KL, Cha DH, Salomon RN, Bianchi DW Transfer of fetal cells with multilineage potential to maternal tissue JAMA 2004;292(1):75-80 Khosrotehrani K, Johnson KL, Gué S, Stroh H, Bianchi DW Natural history of gan fetal cell microchimerism during and following murine pregnancy J Reprod Immunol 2005;66(1):1-12 162 Khosrotehrani K, Johnson KL, Lau J, Dupuy A, Cha DH, Bianchi DW The influence of fetal loss on the presence of fetal cell microchimerism: a systematic review Arthritis Rheum 2003;48(11):3237-3241 Khosrotehrani K, Leduc M, Bachy V, Nguyen Huu S, Oster M, Abbas A, Uzan S, Aractingi S Pregnancy allows the transfer and differentiation of fetal lymphoid progenitors into functional T and B cells in mothers J Immunol 2008;180(2):889-897 Kim CF Paving the road for lung stem cell biology: bronchioalveolar stem cells and other putative distal lung stem cells Am J Physiol Lung Cell Mol Physiol 2007;293(5):L1092-L1098 Kispert A, Koschorz B, Herrmann BG The T protein encoded by Brachyury is a tissue-specific transcription factor EMBO J 1995;14(19):4763-4772 Klintschar M, Schwaiger P, Mannweiler S, Regauer S, Kleiber M Evidence of fetal microchimerism in Hashimoto's thyroiditis J Clin Endocrinol Metab 2001;86(6):2494-2498 Klintschar M, Immel UD, Kehlen A, Schwaiger P, Mustafa T, Mannweiler S, Regauer S, Kleiber M, Hoang-Vu C Fetal microchimerism in Hashimoto's thyroiditis: a quantitative approach Eur J Endocrinol 2006;154(2):237-241 Klonisch T, Drouin R Fetal-maternal exchange of multipotent stem/progenitor cells: microchimerism in diagnosis and disease Trends Mol Med 2009;15(11):510-518 Kokovay E, Goderie S, Wang Y, Lotz S, Lin G, Sun Y, Roysam B, Shen Q, Temple S Adult SVZ lineage cells home to and leave the vascular niche via differential responses to SDF1/CXCR4 signaling Cell stem cell 2010;7(2):163-173 Kolialexi A, Tsangaris GT, Antsaklis A, Mavroua A Rapid clearance of fetal cells from maternal circulation after delivery Ann N Y Acad Sci 2004;1022:113-118 Kollet O, Spiegel A, Peled A, Petit I, Byk T, Hershkoviz R, Guetta E, Barkai G, Nagler A, Lapidot T Rapid and efficient homing of human CD34(+)CD38(/low)CXCR4(+) stem and progenitor cells to the bone marrow and spleen of NOD/SCID and NOD/SCID/B2m(null) mice Blood 2001;97(10):3283-3291 163 Krabchi K, Gadji M, Samassekou O, Gré goire MC, Forest JC, Drouin R Quantification of fetal nucleated cells in maternal blood of pregnant women with a male trisomy 21 fetus using molecular cytogenetic techniques Prenat Diagn 2006;26(1):28-34 Kremer Hovinga ICL, Koopmans M, Baelde HJ, de Heer E, Bruijn JA, Bajema IM Tissue chimerism in systemic lupus erythematosus is related to injury Ann Rheum Dis 2007;66(12):1568-1573 Kuroki M, Okayama A, Nakamura S, Sasaki T, Murai K, Shiba R, Shinohara M, Tsubouchi H Detection of maternal-fetal microchimerism in the inflammatory lesions of patients with Sjö gren's syndrome Ann Rheum Dis 2002;61(12):1041-1046 Lambert NC, Lo YMD, Erickson TD, Tylee TS, Guthrie KA, Furst DE, Nelson JL Male microchimerism in healthy women and women with scleroderma: cells or circulating DNA? A quantitative answer Blood 2002;100(8):2845-2851 Lapaire O, Holzgreve W, Oosterwijk JC, Brinkhaus R, Bianchi DW Georg Schmorl on trophoblasts in the maternal circulation Placenta 2007;28(1):1-5 Lapidot T, Dar A, Kollet O How stem cells find their way home? Blood 2005;106(6):1901-1910 Lee B, Sharron M, Montaner LJ, Weissman D, Doms RW Quantification of CD4, CCR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages Proc Natl Acad Sci U S A 1999;96(9):5215-5220 Lendahl U, Zimmerman LB, McKay RD CNS stem cells express a new class of intermediate filament protein Cell 1990;60(4):585-595 Liegeois A, Gaillard MC, Ouvre E, Lewin D Microchimerism in pregnant mice Transplant Proc 1981;13(1 Pt 2):1250-1252 Little MT, Langlois S, Wilson RD, Lansdorp PM Frequency of fetal cells in sorted subpopulations of nucleated erythroid and CD34+ hematopoietic progenitor cells from maternal peripheral blood Blood 1997;89(7):2347-2358 Lo YM, Bowell PJ, Selinger M, Mackenzie IZ, Chamberlain P, Gillmer MD, Elliott P, Pratt G, Littlewood TJ, Fleming KA Prenatal determination of fetal rhesus D status 164 by DNA amplification of peripheral blood of rhesus-negative mothers Ann N Y Acad Sci 1994;731:229-236 Lo YM, Patel P, Sampietro M, Gillmer MD, Fleming KA, Wainscoat JS Detection of single-copy fetal DNA sequence from maternal blood Lancet 1990;335(8703):14631464 Lothian C, Lendahl U An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells Eur J Neurosci 1997;9(3):452-462 MacPherson H, Keir PA, Edwards CJ, Webb S, Dorin JR Following damage, the majority of bone marrow-derived airway cells express an epithelial marker Respir Res 2006;7:145 Majka SM, Beutz MA, Hagen M, Izzo AA, Voelkel N, Helm KM Identification of novel resident pulmonary stem cells: form and function of the lung side population Stem Cells 2005;23(8):1073-1081 Martin J, Helm K, Ruegg P, Varella-Garcia M, Burnham E, Majka S Adult lung side population cells have mesenchymal stem cell potential Cytotherapy 2008;10(2):140151 Masui S, Nakatake Y, Toyooka Y, Shimosato D, Yagi R, Takahashi K, Okochi H, Okuda A, Matoba R, Sharov AA, Ko MSH, Niwa H Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells Nat Cell Biol 2007;9(6):625-635 Mezey E, Chandross KJ, Harta G, Maki RA, McKercher SR Turning blood into brain: cells bearing neuronal antigens generated in vivo from bone marrow Science 2000;290(5497):1779-1782 Michalczyk K, Ziman M Nestin structure and predicted function in cellular cytoskeletal organisation Histol Histopathol 2005;20(2):665-671 Mikhail MA, M'Hamdi H, Welsh J, Levicar N, Marley SB, Nicholls JP, Habib NA, Louis LS, Fisk NM, Gordon MY High frequency of fetal cells within a primitive stem cell population in maternal blood Hum Reprod 2008;23(4):928-933 165 Molkentin JD The zinc finger-containing transcription factors GATA-4, -5, and -6 Ubiquitously expressed regulators of tissue-specific gene expression J Biol Chem 2000;275(50):38949-38952 Morshead CM, Craig CG, van der Kooy D In vivo clonal analyses reveal the properties of endogenous neural stem cell proliferation in the adult mammalian forebrain Development 1998;125(12):2251-2261 Mueller UW, Hawes CS, Wright AE, Petropoulos A, DeBoni E, Firgaira FA, Morley AA, Turner DR, Jones WR Isolation of fetal trophoblast cells from peripheral blood of pregnant women Lancet 1990;336(8709):197-200 Mü AM, Hermanns MI, Skrzynski C, Nesslinger M, Mü KM, Kirkpatrick CJ ller ller Expression of the endothelial markers PECAM-1, vWf, and CD34 in vivo and in vitro Exp Mol Pathol 2002;72(3):221-229 Nelson JL Maternal-fetal immunology and autoimmune disease: is some autoimmune disease auto-alloimmune or allo-autoimmune? Arthritis Rheum 1996;39(2):191-194 Nguyen Huu S, Khosrotehrani K, Oster M, Moguelet P, EspiéMJ, Aractingi S Early phase of maternal skin carcinogenesis recruits long-term engrafted fetal cells Int J Cancer 2008;123(11):2512-2517 Nguyen Huu S, Oster M, Avril MF, Boitier F, Mortier L, Richard MA, Kerob D, Maubec E, Souteyrand P, Moguelet P, Khosrotehrani K, Aractingi S Fetal microchimeric cells participate in tumour angiogenesis in melanomas occurring during pregnancy Am J Pathol 2009;174(2):630-637 Nguyen Huu S, Oster M, Uzan S, Chareyre F, Aractingi S, Khosrotehrani K Maternal neoangiogenesis during pregnancy partly derives from fetal endothelial progenitor cells Proc Natl Acad Sci U S A 2007;104(6):1871-1876 Nicolay DJ, Doucette JR, Nazarali AJ Transcriptional regulation of neurogenesis in the olfactory epithelium Cell Mol Neurobiol 26(4-6):803-821 North TE, de Bruijn MFTR, Stacy T, Talebian L, Lind E, Robin C, Binder M, Dzierzak E, Speck NA Runx1 expression marks long-term repopulating hematopoietic stem cells in the midgestation mouse embryo Immunity 2002;16(5):661-672 166 Novak A, Guo C, Yang W, Nagy A, Lobe CG Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision Genesis 2000;28(3-4):147-155 O'Donoghue K, Choolani M, Chan J, de la Fuente J, Kumar S, Campagnoli C, Bennett PR, Roberts IAG, Fisk NM Identification of fetal mesenchymal stem cells in maternal blood: implications for non-invasive prenatal diagnosis Mol Hum Reprod 2003;9(8):497-502 O'Donoghue K, Chan J, de la Fuente J, Kennea N, Sandison A, Anderson JR, Roberts IAG, Fisk NM Microchimerism in female bone marrow and bone decades after fetal mesenchymal stem-cell trafficking in pregnancy Lancet 2004;364(9429):179-182 O'Donoghue K, Sultan HA, Al-Allaf FA, Anderson JR, Wyatt-Ashmead J, Fisk NM Microchimeric fetal cells cluster at sites of tissue injury in lung decades after pregnancy Reprod Biomed Online 2008;16(3):382-390 Ogle BM, Cascalho M, Platt JL Biological implications of cell fusion Nat Rev Mol Cell Biol 2005;6(7):567-575 Osada H, Doi S, Fukushima T, Nakauchi H, Seki K, Sekiya S Detection of fetal HPCs in maternal circulation after delivery Transfusion 2001;41(4):499-503 Oudejans CBM, Tjoa ML, Westerman BA, Mulders MAM, Van Wijk IJ, Van Vugt JMG Circulating trophoblast in maternal blood Prenat Diagn 2003;23(2):111-116 Pain D, Chirn GW, Strassel C, Kemp DM Multiple retropseudogenes from pluripotent cell-specific gene expression indicates a potential signature for novel gene identification J Biol Chem 2005;280(8):6265-6268 Pan GJ, Chang ZY, Schö HR, Pei D Stem cell pluripotency and transcription ler factor Oct4 Cell Res 2002;12(5-6):321-329 Parant O, Dubernard G, Challier JC, Oster M, Uzan S, Aractingi S, Khosrotehrani K CD34+ cells in maternal placental blood are mainly fetal in origin and express endothelial markers Lab Invest 2009;89(8):915-923 Park D, Sykes DB, Scadden DT The hematopoietic stem cell niche Front Biosci 2012;17:30-39 167 Peled A, Petit I, Kollet O, Magid M, Ponomaryov T, Byk T, Nagler A, Ben-Hur H, Many A, Shultz L, Lider O, Alon R, Zipori D, Lapidot T Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4 Science 1999;283(5403):845-848 Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Murase N, Boggs SS, Greenberger JS, Goff JP Bone marrow as a potential source of hepatic oval cells Science 1999;284(5417):1168-1170 Piper KP, McLarnon A, Arrazi J, Horlock C, Ainsworth J, Kilby MD, Martin WL, Moss PA Functional HY-specific CD8+ T cells are found in a high proportion of women following pregnancy with a male fetus Biol Reprod 2007;76(1):96-101 Preis JI, Downes M, Oates NA, Rasko JEJ, Whitelaw E Sensitive flow cytometric analysis reveals a novel type of parent-of-origin effect in the mouse genome Curr Biol 2003;13(11):955-959 Purwosunu Y, Sekizawa A, Koide K, Okazaki S, Farina A, Okai T Clinical potential for noninvasive prenatal diagnosis through detection of fetal cells in maternal blood Taiwan J Obstet Gynecol 2006;45(1):10-20 Pusztaszeri MP, Seelentag W, Bosman FT Immunohistochemical expression of endothelial markers CD31, CD34, von Willebrand factor, and Fli-1 in normal human tissues J Histochem Cytochem 2006;54(4):385-395 Ramos-Vara JA Technical aspects of immunohistochemistry Vet Pathol 2005;42(4):405-426 Ransohoff RM, Kivisä P, Kidd G Three or more routes for leukocyte migration kk into the central nervous system Nat Rev Immunol 2003;3(7):569-581 Robson P, Stein P, Zhou B, Schultz RM, Baldwin HS Inner cell mass-specific expression of a cell adhesion molecule (PECAM-1/CD31) in the mouse blastocyst Dev Biol 2001;234(2):317-329 Rosu-Myles M, Gallacher L, Murdoch B, Hess DA, Keeney M, Kelvin D, Dale L, Ferguson SS, Wu D, Fellows F, Bhatia M The human hematopoietic stem cell compartment is heterogeneous for CXCR4 expression Proc Natl Acad Sci U S A 2000;97(26):14626-14631 168 Russ AP, Wattler S, Colledge WH, Aparicio SA, Carlton MB, Pearce JJ, Barton SC, Surani MA, Ryan K, Nehls MC, Wilson V, Evans MJ Eomesodermin is required for mouse trophoblast development and mesoderm formation Nature 2000;404(6773):9599 Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li J, Thiagarajan M, White JA, Quackenbush J TM4 microarray software suite Methods Enzymol 2006;411:134-193 Sansom SN, Griffiths DS, Faedo A, Kleinjan DJ, Ruan Y, Smith J, van Heyningen V, Rubenstein JL, Livesey FJ The level of the transcription factor Pax6 is essential for controlling the balance between neural stem cell self-renewal and neurogenesis PLoS Genet 2009;5(6):e1000511 Sato T, Fujimori K, Sato A, Ohto H Microchimerism after induced or spontaneous abortion Obstet Gynecol 2008;112(3):593-597 Sawaya HHB, Jimenez SA, Artlett CM Quantification of fetal microchimeric cells in clinically affected and unaffected skin of patients with systemic sclerosis Rheumatology (Oxford) 2004;43(8):965-968 Scaletti C, Vultaggio A, Bonifacio S, Emmi L, Torricelli F, Maggi E, Romagnani S, Piccinni MP Th2-oriented profile of male offspring T cells present in women with systemic sclerosis and reactive with maternal major histocompatibility complex antigens Arthritis Rheum 2002;46(2):445-450 Schmidt M, Hoffmann B, Beelen D, Gellhaus A, Winterhager E, Kimmig R, KasimirBauer S Detection of circulating trophoblast particles in peripheral maternal blood in preeclampsia complicated pregnancies Hypertens Pregnancy 2008;27(2):131-142 Scholzen T, Gerdes J The Ki-67 protein: from the known and the unknown J Cell Physiol 2000;182(3):311-322 Schrepfer S, Deuse T, Reichenspurner H, Fischbein MP, Robbins RC, Pelletier MP Stem cell transplantation: the lung barrier Transplant Proc 2007;39(2):573-576 Sejersen T, Lendahl U Transient expression of the intermediate filament nestin during skeletal muscle development J Cell Sci 1993;106 ( Pt 4):1291-1300 169 Selander L, Edlund H Nestin is expressed in mesenchymal and not epithelial cells of the developing mouse pancreas Mech Dev 2002;113(2):189-192 Simpson JL, Elias S Isolating fetal cells from maternal blood Advances in prenatal diagnosis through molecular technology JAMA 1993;270(19):2357-2361 Sipos PI, Crocker IP, Hubel CA, Baker PN Endothelial progenitor cells: their potential in the placental vasculature and related complications Placenta 2010;31(1):1-10 Smith SC, Baker PN, Symonds EM Placental apoptosis in normal human pregnancy Am J Obstet Gynecol 1997;177(1):57-65 Spagnoli FM, Hemmati-Brivanlou A Guiding embryonic stem cells towards differentiation: lessons from molecular embryology Curr Opin Genet Dev 2006;16(5):469-475 Stevens AM, McDonnell WM, Mullarkey ME, Pang JM, Leisenring W, Nelson JL Liver biopsies from human females contain male hepatocytes in the absence of transplantation Lab Invest 2004;84(12):1603-1609 Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F, Rossant J Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst Development 2005;132(9):2093-2102 Summer R, Kotton DN, Sun X, Fitzsimmons K, Fine A Translational physiology: origin and phenotype of lung side population cells Am J Physiol Lung Cell Mol Physiol 2004;287(3):L477-L483 Sunami R, Komuro M, Tagaya H, Hirata S Migration of microchimeric fetal cells into maternal circulation before placenta formation Chimerism (Print) 2010;1(2):6668 Suzuki S, Namiki J, Shibata S, Mastuzaki Y, Okano H The neural stem/progenitor cell marker nestin is expressed in proliferative endothelial cells, but not in mature vasculature J Histochem Cytochem 2010;58(8):721-730 170 Swenson ES, Price JG, Brazelton T, Krause DS Limitations of green fluorescent protein as a cell lineage marker Stem Cells 2007;25(10):2593-2600 Tallquist MD, Soriano P Epiblast-restricted Cre expression in MORE mice: a tool to distinguish embryonic vs extra-embryonic gene function Genesis 2000;26(2):113115 Tan KH, Zeng XX, Sasajala P, Yeo A, Udolph G Fetomaternal microchimerism: Some answers and many new questions Chimerism (Print) 2011;2(1):16-18 Tan XW, Liao H, Sun L, Okabe M, Xiao ZC, Dawe GS Fetal microchimerism in the maternal mouse brain: a novel population of fetal progenitor or stem cells able to cross the blood-brain barrier? Stem Cells 2005;23(10):1443-1452 Theriault FM, Nuthall HN, Dong Z, Lo R, Barnabe-Heider F, Miller FD, Stifani S Role for Runx1 in the proliferation and neuronal differentiation of selected progenitor cells in the mammalian nervous system J Neurosci 2005;25(8):2050-2061 Toda I, Kuwana M, Tsubota K, Kawakami Y Lack of evidence for an increased microchimerism in the circulation of patients with Sjö gren's syndrome Ann Rheum Dis 2001;60(3):248-253 Tronche F, Kellendonk C, Kretz O, Gass P, Anlag K, Orban PC, Bock R, Klein R, Schü G Disruption of the glucocorticoid receptor gene in the nervous system results tz in reduced anxiety Nat Genet 1999;23(1):99-103 Uy GD, Downs KM, Gardner RL Inhibition of trophoblast stem cell potential in chorionic ectoderm coincides with occlusion of the ectoplacental cavity in the mouse Development 2002;129(16):3913-3924 Vassilopoulos G, Russell DW Cell fusion: an alternative to stem cell plasticity and its therapeutic implications Curr Opin Genet Dev 2003;13(5):480-485 Vernay B, Koch M, Vaccarino F, Briscoe J, Simeone A, Kageyama R, Ang SL Otx2 regulates subtype specification and neurogenesis in the midbrain J Neurosci 2005;25(19):4856-4867 Vernochet C, Caucheteux SM, Kanellopoulos-Langevin C Bi-directional cell trafficking between mother and fetus in mouse placenta Placenta 2007;28(7):639-649 171 Walknowska J, Conte FA, Grumbach MM Practical and theoretical implications of fetal-maternal lymphocyte transfer Lancet 1969;1(7606):1119-1122 Wang L, Wang Y, Liu Y, Cheng M, Wu X, Wei H Flow cytometric analysis of CK19 expression in the peripheral blood of breast carcinoma patients: relevance for circulating tumor cell detection J Exp Clin Cancer Res 2009;28:57 Wang Y, Iwatani H, Ito T, Horimoto N, Yamato M, Matsui I, Imai E, Hori M Fetal cells in mother rats contribute to the remodeling of liver and kidney after injury Biochem Biophys Res Commun 2004;325(3):961-967 Westgren M, Ek S, Bui T, Jansson B, Kjaeldgaard A, Markling L, Nennesmo I, Seiger A, Sarby B, Thornströ S, Ringden O Tissue distribution of transplanted fetal liver m cells in the human fetal recipient Am J Obstet Gynecol 1997;176(1 Pt 1):49-53 Wiese C, Rolletschek A, Kania G, Blyszczuk P, Tarasov KV, Tarasova Y, Wersto RP, Boheler KR, Wobus AM Nestin expression a property of multi-lineage progenitor cells? Cell Mol Life Sci 2004;61(19-20):2510-2522 Wurmser AE, Gage FH Stem cells: cell fusion causes confusion Nature 2002;416(6880):485-487 Wurmser AE, Nakashima K, Summers RG, Toni N, D'Amour KA, Lie DC, Gage FH Cell fusion-independent differentiation of neural stem cells to the endothelial lineage Nature 2004;430(6997):350-356 Yan Z, Lambert NC, Guthrie KA, Porter AJ, Loubiere LS, Madeleine MM, Stevens AM, Hermes HM, Nelson JL Male microchimerism in women without sons: quantitative assessment and correlation with pregnancy history Am J Med 2005;118(8):899-906 You F, Roberts LA, Kang SP, Nunes RA, Dias C, Iglehart JD, Solomon NA, Friedman PN, Harris LN Low-level expression of HER2 and CK19 in normal peripheral blood mononuclear cells: relevance for detection of circulating tumor cells Journal of hematology & oncology 2008;1:2 Yunis EJ, Zuniga J, Romero V, Yunis EJ Chimerism and tetragametic chimerism in humans: implications in autoimmunity, allorecognition and tolerance Immunol Res 2007;38(1-3):213-236 172 Zangrossi S, Marabese M, Broggini M, Giordano R, D'Erasmo M, Montelatici E, Intini D, Neri A, Pesce M, Rebulla P, Lazzari L Oct-4 expression in adult human differentiated cells challenges its role as a pure stem cell marker Stem Cells 2007;25(7):1675-1680 Zeng XX, Tan KH, Yeo A, Sasajala P, Tan X, Xiao ZC, Dawe G, Udolph G Pregnancy-associated progenitor cells differentiate and mature into neurons in the maternal brain Stem Cells Dev 2010;19(12):1819-1830 Zhang J, Niu C, Ye L, Huang H, He X, Tong WG, Ross J, Haug J, Johnson T, Feng JQ, Harris S, Wiedemann LM, Mishina Y, Li L Identification of the haematopoietic stem cell niche and control of the niche size Nature 2003;425(6960):836-841 Zhong JF, Weiner LP Role of fetal stem cells in maternal tissue regeneration Gene regulation and systems biology : 2007;1:111-115 Zimmerman L, Parr B, Lendahl U, Cunningham M, McKay R, Gavin B, Mann J, Vassileva G, McMahon A Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors Neuron 1994;12(1):11-24 173 ... gaggagtttccatcacgaaga gacgtagcctggtgtctcg ccatgtacccagacatccact gagcagcaacatcaccacag cccctcattaagcctcagc ccaagaggtccatggtgttt gaaatccaccaaagctcacg gcggagctcagcaagatg ctaaggccaaccgtgaaaag cacatgaagcagcacgactt... tggaaccgatcagtgtgagt agaggaagggcgaggaga ctccttctgcagggctttc tcgggctccaaacttctct ctgcggttctgaaaccaaat aagctcaagaaaggaaacatgc ggtgtctgcaagcgagagtt tggcgtggacgactcatac accgcccttggttaaagtct cgagctgtgccctagtaaatg... ttcttgcttacaagggtctgc gttggagaaggtggaaccaa tgctgcctctttaagactaggg caccatcaggaggaaaagtga accggcaccaaactgaga tcccttagtctggaagtggcta ccccagctctctgcgtaa gttccctgtcctgtggactc ttcgggtatggacttgctg tggaaccgatcagtgtgagt