... a pattern of progressive adenocarcinoma with similar genetic changes and pathophysiology as seen in human breast cancers associated with BRCA1-mutations [11 ,12 ] Additionally, as in human BRCA1-associated ... measured using a RIA kit containing microplates coated with the capture antibody and a I125 labeled detector antibody (Alpco Diagnostic, Salem, NH) The assay was performed according to manufacturer’s ... Sim SJ: Ultrasensitive carbon nanotube-based biosensors using antibody-binding fragments Anal Biochem 2008, 3 81: 193 -19 8 21 Maehashi K, Matsumoto K, Takamura Y, Tamiya E: Aptamer-Based LabelFree...
Ngày tải lên: 11/08/2014, 00:23
... Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene ... intervertebral disc Spine 19 90, 15 : 411 - 415 doi :10 .11 86/ar3423 Cite this article as: Mwale et al.: The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration Arthritis ... biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the design of...
Ngày tải lên: 12/08/2014, 17:22
Báo cáo y học: " Local therapy with CpG motifs in a murine model of allergic airway inflammation in IFN-β knock-out mice" doc
... mice Pharmacology 19 97, 55:32-43 Satoh Y, Kasama K, Kuwabara M, Yimin, Diao HY, Nakajima H, Kohanawa M, Minagawa T: Suppression of late asthmatic response by low-dose oral administration of interferon-beta ... interleukin and granulocyte macrophage-colony- stimulating factor mRNA at sites of allergic inflammation in asthmatics J Clin Invest 19 92, 90 :14 14 -14 24 Broide DH, Stachnick G, Castaneda D, Nayar J, ... both strain of mice resulted in similar reduction of percentage of infiltrating eosinophils in BALF (Table 1) Treatment with CpG-ODN inhibits total number of infiltrating cells in airways in WT...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: " Changes in the central component of the hypothalamus-pituitary-thyroid axis in a rabbit model of prolonged critical illness" ppsx
... 5'-GAACAACATGCATTCCGAGAAG-3' Forward: 5'-GCGCAGCGCGTTGAA-3' Probe: 5'-AACGAACAGTCATCACCACATCTCATCCAG-3' Reverse: 5'-GGATGGAGCTCGTCCAAGTG-3' Forward: 5'-GCCATCCTGACTATTTCACTGAAGA-3' Probe: 5'-AAGCCTACTTTTTCTCAAGGGCAGTCACCG-3' ... used as an internal control Statistical analysis All statistical analyses were done using StatView software (SAS Institute Inc., Cary, NC, USA) Data were analyzed using one-way analysis of variance ... 14 5:4384-43 91 Sugiyama D, Kusuhara H, Taniguchi H, Ishikawa S, Nozaki Y, Aburatani H, Sugiyama Y: Functional characterization of rat brainspecific organic anion transporter (Oatp14) at the blood-brain barrier:...
Ngày tải lên: 13/08/2014, 19:20
The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro
... domain and a C-terminal caspase activation and recruitment domain (CARD) that is necessary for the binding of caspase -1 to the inflammasome (Martinon and Tschopp 2007) 1. 5.2 Early inflammatory ... (IL -1 ) and IL -18 are processed via caspase -1 in the inflammasome This study investigated the role of caspase -1 in influenza virus-associated pulmonary pathology and inflammation using a mouse model ... caspase -10 , function upstream of the effector caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase -1, caspase-4, caspase-5, caspase -11 ...
Ngày tải lên: 13/10/2015, 16:41
Báo cáo y học: "Kinematic and dynamic gait compensations in a rat model of lumbar radiculopathy and the effects of tumor necrosis factor-alpha antagonis" ppsx
... p38 MAP kinase mediates pain in a rat model of lumbar disc herniation and induces motor dysfunction in a rat model of lumbar spinal canal stenosis Spine (Phila Pa 19 76) 2007, 32 :15 9 -16 7 Igarashi ... to investigate gait dynamics associating with lumbar radiculopathy in a rat model Amongst measures of gait dynamics, vertical impulse appears to be strongly affected by lumbar radiculopathy in ... Kinematic and dynamic gait compensations in a rat model of lumbar radiculopathy and the effects of tumor necrosis factor-alpha antagonism Kyle D Allen1,2, Mohammed F Shamji1,3, Brian A Mata2,...
Ngày tải lên: 12/08/2014, 17:22
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... Medicine 2 011 , 9:39 http://www.translational-medicine.com/content/9 /1/ 39 10 11 12 13 14 15 16 17 18 19 20 21 22 Fukazawa T, Matsuoka J, Yamatsuji T, Maeda Y, Durbin ML, Naomoto Y: Adenovirus-mediated ... eosin stained major organs (Figure 5) Taking all these data into consideration, it appears that combination therapy of AdhTERTHRP/IAA and AdCMVmIL -12 had the best therapeutic effect in terms of ... Journal of Translational Medicine 2 011 , 9:39 http://www.translational-medicine.com/content/9 /1/ 39 Page of 10 Figure General outline of the in vivo experimentation with mouse model of LLC ANOVA analysis...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc
... Medicine 2 011 , 9:39 http://www.translational-medicine.com/content/9 /1/ 39 10 11 12 13 14 15 16 17 18 19 20 21 22 Fukazawa T, Matsuoka J, Yamatsuji T, Maeda Y, Durbin ML, Naomoto Y: Adenovirus-mediated ... eosin stained major organs (Figure 5) Taking all these data into consideration, it appears that combination therapy of AdhTERTHRP/IAA and AdCMVmIL -12 had the best therapeutic effect in terms of ... Journal of Translational Medicine 2 011 , 9:39 http://www.translational-medicine.com/content/9 /1/ 39 Page of 10 Figure General outline of the in vivo experimentation with mouse model of LLC ANOVA analysis...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo y học: "Acoustic stiffness and change in plug cartilage over time after autologous osteochondral grafting: correlation between ultrasound signal intensity and histological score in a rabbit model" pdf
... each in a separate cage, in a room maintained at 22°C and 50% humidity, with a 14 -hour light/ 10 -hour dark cycle, and were given food and water ad libitum 1) A parapatellar incision 2) Patella ... faint At 12 and 24 weeks, the surface of the plug cartilage was as smooth as that of the adjacent intact cartilage Although the plug and intact cartilage were glossy in all of the specimens obtained ... parameters of human and bovine articular cartilage following experimentally-induced matrix degradation Ultrason Imaging 20 01, 23 :10 6 -11 6 28 Barber FA, Chow JC: Arthroscopic osteochondral transplanta-...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt
... tissueengineered cartilage Rheumatology 2004, 43 :11 06 -11 08 Laasanen MS, Töyräs J, Vasara A, Saarakkala S, Hyttinen MM, Kiviranta I, Jurvelin JS: Quantitative ultrasound imaging of spontaneous repair of ... surrounding articular surface and maintained the characteristics of hyaline cartilage The histological findings of group F Table L* a* b* color change of the plug cartilage at and 12 weeks after ... determined the standard L*, a* and b* values and the standard spectral reflectance ratio of intact articular cartilage in Japanese white rabbits (Figure 1) As a coincidence index for the spectral...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx
... levels of active and latent/total TGF- 1 at baseline and after CYP Active and latent/total TGF- 1 values are reported as pg/mg of creatinine Panel A Urine levels of TGF- 1 at baseline In the absence ... difference in the magnitude of tissue levels for latent TGF- 1 (panel B) and active TGF 1 (panel A) was maintained across all groups The substantial levels of latent TGF- 1 in female rats at baseline and ... mediator of the resolution of inflammation and induction of healing and in the bladder Our results therefore argue in favor of evaluating urinary TGF- 1 in IC patients in order to assess disease...
Ngày tải lên: 11/08/2014, 08:22
Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx
... (trauma) Baseline Haemodilution Fibrinogen after Trauma Trauma Control 83 ± 15 99 ± 11 99 ± 10 11 5 ± 12 15 5 ± 22 F-70 86 ± 12 92 ± 13 84 ± 11 11 0 ± 10 14 6 ± 15 F-200 87 ± 13 81 ± 18 82 ± 12 12 7 ± 14 ... were used at a concentration of 1: 100 For staining, the ABC Vectastain universal kit (Vector Laboratories, Burlingame, CA, USA) and haematoxylin as counterstain was used A blinded pathologist ... isoflurane at end-tidal concentrations of 1% to 1. 2% and continuous infusion of fentanyl at μg kg -1 h1 Ringer's lactated solution (RL) was infused at mL kg1h -1 at first and increased to mL kg-1h-1after...
Ngày tải lên: 13/08/2014, 20:21
Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis
... swelling, heat, and pain localized to a tissue A rapid and prominent increase in pancreatic inflammation is a hall-mark of acute pancreatitis (AP) A majority of AP cases can be attributed to gallstones ... products, as well as NK1R, are critical pro-inflammatory mediators in AP and the associated lung injury SP-NK1R interaction is also a determinant of inflammatory edema in acute interstitial pancreatitis ... reduced inflammation and pancreatic injury in caerulein-induced AP (Nathan et al., 20 01) On the other hand, activation of TRPV1 by capsaicin caused release of SP, and exaggerated caerulein-induced...
Ngày tải lên: 09/09/2015, 17:54
Muscarinic mechanisms in a mouse model of myopia 1
... include dopamine (Stone et al 19 91, Iuvone et al 19 91, Schaeffel et al 19 95, Lin et al 19 88), VIP (Stone et al 19 88, Butler et al 19 84, Erikson and Larson 19 81, Raviola et al 19 91) , muscarinic antagonists ... myopia as well as human myopia involves more than just weakening and stretching of sclera and may involve biochemical or molecular changes associated with growth and remodelling The cardinal characteristic ... et al 19 92) Atropine can prevent the development of form deprivation myopia in tree shrews (Mckanna and Casagrande 19 85) and chicks (Stone et al 19 91) Atropine is used as a cycloplegic agent in...
Ngày tải lên: 16/09/2015, 08:31
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
... cDNA sequence of rat TLR4 (GenBank accession NM_ 019 178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically ... be of practical value in clinical situation Conflict of Interest The authors have declared that no conflict of interest exists 258 References 10 11 12 13 14 15 16 17 18 19 Bouhassira D., Lantéri-Minet ... neuropathic pain In addition, we have also demonstrated that suppression of TLR4 with intrathecal siRNA delivery could alleviate pain responses in a rat CCI model, suggesting that siRNA targeting...
Ngày tải lên: 25/10/2012, 11:48
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... Proteomics of a PD model T Alberio et al A Fig Induction of apoptosis Apoptotic b-gal and a- syn cells are measured as a percentage of annexin V positive cells in response to dopamine treatment DA **P ... UÆmL )1 catalase to eliminate aspecific effects as a result of H2O2 arising from dopamine auto-oxidation [45] A5 70 was monitored with a Universal Microplate reader Model 550 (Bio-Rad, Hercules, CA, ... the presence of catalase only (cat) or in the presence of catalase and 0.250 mm dopamine for 24 h (DA) Dopamine treatment significantly increased the expression of a- synuclein in b-gal control cells...
Ngày tải lên: 15/02/2014, 01:20
Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt
... with an intra-peritoneal injection of 400 mg/kg chloral hydrate (Pharmaceutical Plant of Tiantan Hospital, Beijing, China) The rectal temperature was monitored and maintained at 37.5°C A scalp incision ... infarcted brain parenchyma of transplanted rats (A- iii and A- iv) A comparable extent of class II MHC was noted in ischemic rats irrespective of any therapy but unremarkable in normal rat (panel ... 10 of 10 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Stampachiacchiere B, Aloe L: Differential modulatory effect of NGF on MHC class I and class II expression in spinal cord cells of EAE rats J...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Induction of Th1Immune responses following laser ablation in a murine model of colorectal liver metastase" potx
... grading system used was: as: 0: no staining 1: faint staining; 2: small amount or weak staining; 3: moderate staining; 4: abundant or strong staining; 5: Abundant or very strong staining Means ... (MAb XMG. 21- biotin; Pharmingen, Australia) followed by extravidin-alkaline phosphatase at 10 0 μg/mL (Sigma) Spots of activity were detected with a colorimetric alkaline phosphatase kit (Bio-Rad, ... increases were also seen at the tumor host interface of ablated and distant tumors, at the ablation injury front and within vascular lakes of ablated and distant tumors These increases persisted at...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Combination immunotherapy and active-specific tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer" pdf
... Tokunaga N, Ikeda Y, Ishihara Y, Yamada A, Tanaka N, Itoh K, Harada M, Todo S: Immunological evaluation of personalized peptide vaccination in combination with a 5-fluorouracil derivative (TS -1) ... that they may exhibit comparable therapeutic potential Indeed, prophylactic vaccination with the DC vaccine van den Engel et al Journal of Translational Medicine 2 011 , 9 :14 0 http://www.translational-medicine.com/content/9 /1/ 140 ... s.c vaccination with irradiated mGC8 cells (10 7, 10 ,000 rad) with or without a s.c injection of GM- van den Engel et al Journal of Translational Medicine 2 011 , 9 :14 0 http://www.translational-medicine.com/content/9 /1/ 140...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Selective COX-2 inhibition prevents progressive dopamine neuron degeneration in a rat model of Parkinson''''s disease" potx
... animal of each group As reported in our previous study [28] 6-OHDA injection resulted in a marked decrease of 11 C-CFT binding in the striatum and a parallel increase in 11 C PK -11 195 binding in ... J, Machado A: Lipopolysaccharide intranigral injection induces inflammatory reaction and damage in nigrostriatal dopaminergic system J Neurochem 19 98, 70 :15 84 -15 92 14 15 16 17 18 19 20 21 22 ... images of 11 C-CFT ((2β-carbomethoxy-3β-(4-fluorophenyl) tropane, a dopamine transporter ligand) and 11 C-PK 111 95 (a peripheral-type benzodiazepine ligand that binds to microglia) in a representative...
Ngày tải lên: 19/06/2014, 22:20