Endofin is a novel component in EGR EGFR oncogenic signaling

... by APPL and this in turn may affect the intensity of MAPK signaling 1.8 FYVE domain-containing proteins A group of proteins that are also implicated in EGFR trafficking and signaling are the ... via EGFR- containing endosomes Gathering from all the above data, it is hard to formulate a role for 34 endocytosis in EGFR signaling, especially in the case of MAPK signaling...

Ngày tải lên: 11/09/2015, 10:00

... length Vgf content in CSF in ALS In A, full-length Vgf was assessed by quantitative ELISA assays; in B, Vgf content decreased as a function of progression of muscle weakness assessed by manual muscle ... Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic late...

Ngày tải lên: 03/11/2012, 10:52

... motifs that are characteristic of RNA-binding proteins, and an alanine-rich carboxy-terminal sequence that could be involved in protein–protein interactions Interestingly, this alanine-rich sequence, ... Gld2 Rbm9 interaction (Fig 2B) However, the RRM-containing central domain of hRbm9 (amino acids 48–269) and amino acids 269–350 of hRbm9 are not able to mediate the binding These...

Ngày tải lên: 07/03/2014, 05:20

... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351 -SUT2 was constructed to contain SUT2 as the ... yeast/ info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACA...

Ngày tải lên: 07/03/2014, 15:20

... differentiation by binding to b-catenin [17] FHL3 regulates a- actinin-mediated actin bundling as an actinbinding protein [18] CRP3 (also called muscle LIM protein MLP) plays an important role in myogenesis ... hhLIM Ab hhLIM + Actin Actin – hhLIM Total lysates Total lysates Actin hhLIM C GST GST -hhLIM Actin GST Fig Actin interacts with hhLIM in C2C12 cells Coi...

Ngày tải lên: 16/03/2014, 06:20

... Under the Guidance of Professor Hyoung-Chun Kim Microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice A THESIS Submitted ... laminar distribution of A plaques in AD It is reasonable to speculate that the mEH activation around some plaques is at least partially derived fr...

Ngày tải lên: 12/06/2014, 15:50

... caspase 1, WEHD-AMC; caspase 2, VDVADAMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5, WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; caspase 8, IETD-AMC; caspase 9, LEHD-AMC; caspase ... substrates and their inhibitors were purchased from Biomol Ac-DEVD-AMC is a substrate for caspases and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC is a substrate for cas...

Ngày tải lên: 19/02/2014, 13:20

... uterine cervix, breast and urinary bladder is shown NANOGP8 was expressed in all of the human cancer tissues that were tested NANOGP8 was not expressed in human fibroblasts Nanog was expressed in ... that NANOGP8 was transcribed in all of the human cancer tissues tested (Table and Fig 2) as well as in several cancer cell lines In contrast, Nanog and NANOGP8 were not...

Ngày tải lên: 07/03/2014, 12:20

... LJY430 LJY431 LJY432 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa Euroscarf [16] ATCC [15] This study ... the yeast deubiquitinating enzyme Ubp16, a metalloprotease belonging to the large family of deubiquitinating enzymes, mainly consisting of cysteine proteases [43] Another class of p...

Ngày tải lên: 07/03/2014, 16:20

... pcDNA3.1-GST -Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CG...

Ngày tải lên: 23/03/2014, 07:20

... first L-amino acid amidase whose primary sequence is revealed Acknowledgements We are grateful to S Iwamoto, R Kasahara and A Nakayama (Toyama Prefectural University) for their technical assistance ... ethylenediaminetetraacetic acid and o-phenanthroline and/or activated by divalent cations (Table 4) Comparison of the characteristics of LaaA with those of the other L-amino aci...

Ngày tải lên: 23/03/2014, 12:20

... demonstrates antibacterial activity against E coli, and was dramatically induced in the liver following the challenge with fish pathogen, S iniae ACKNOWLEDGEMENTS This research was supported in part by ... (24 amino acids); (b) a prodomain (40 amino acids); and (c) a mature peptide (21 amino acids) (Fig 3) A canonical polyadenylation signal was found in the 3¢ UTR White bass h...

Ngày tải lên: 24/03/2014, 03:21

... 4242 analysis This approach identified the Promyelocytic Leukemia Zinc Finger (PLZF) gene as a putative gene target of CUX1 PLZF was originally identified as a t(11;1 7) reciprocal chromosomal translocation ... Chip1up primer (5¢-aagctccagagggtctgcac-3 ) and Chip1dw primer (5¢-gaaaggcatcccgaacgcat-3 ); Chip2up primer (5¢-aaatgtcttgaccagccgtc-3 ) and Chip2dw p...

Ngày tải lên: 29/03/2014, 21:20

... 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as ... is a crucial component of the protein phosphorylation cascade involved in CaS phosphorylation Characterization of the CaS mutant lines The mutant Arabidopsis lines with T-D...

Ngày tải lên: 30/03/2014, 04:20

... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism by which ... dephosphorylation of phosphorylase a [16], that inactivation of GSK-3 in the absence of phosphorylase inactivation is a small compo...

Ngày tải lên: 31/03/2014, 01:20