Endofin is a novel component in EGR EGFR oncogenic signaling
Endofin is a novel component in EGR EGFR oncogenic signaling
... by APPL and this in turn may affect the intensity of MAPK signaling 1.8 FYVE domain-containing proteins A group of proteins that are also implicated in EGFR trafficking and signaling are the ... via EGFR- containing endosomes Gathering from all the above data, it is hard to formulate a role for 34 endocytosis in EGFR signaling, especially in the case of MAPK signaling Nevertheless, it is ... phagocytosis, dynamin-dependent caveolin-1 associated caveolar endocytosis, a CIE pathway that involves CDC42, ADP-ribosylation factor (ARF1), actin and another mode of CIE which is dynamin-independent...
- 135
- 225
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... length Vgf content in CSF in ALS In A, full-length Vgf was assessed by quantitative ELISA assays; in B, Vgf content decreased as a function of progression of muscle weakness assessed by manual muscle ... Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis BMC Neurosci 2006; 7: 29 Chakraborty ... precedes ALS-type muscle weakness in ~90 day-old symptomatic mutant G9 3A- SOD-1 mice and continue to decline as a function of progression of ALS-type clinical disease Values are expressed as mean ±...
- 8
- 499
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... motifs that are characteristic of RNA-binding proteins, and an alanine-rich carboxy-terminal sequence that could be involved in protein–protein interactions Interestingly, this alanine-rich sequence, ... Gld2 Rbm9 interaction (Fig 2B) However, the RRM-containing central domain of hRbm9 (amino acids 48–269) and amino acids 269–350 of hRbm9 are not able to mediate the binding These data suggest that ... XGld2 to specific mRNA The molecular mechanism underlying XRbm9-dependent translational activation is unclear and awaits further investigations The subcellular localization of mammalian Rbm9 is...
- 14
- 502
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351 -SUT2 was constructed to contain SUT2 as the ... yeast/ info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively ... The cassette was amplified from the plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA...
- 8
- 485
- 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... differentiation by binding to b-catenin [17] FHL3 regulates a- actinin-mediated actin bundling as an actinbinding protein [18] CRP3 (also called muscle LIM protein MLP) plays an important role in myogenesis ... hhLIM Ab hhLIM + Actin Actin – hhLIM Total lysates Total lysates Actin hhLIM C GST GST -hhLIM Actin GST Fig Actin interacts with hhLIM in C2C12 cells Coimmunoprecipitation of GFP-tagged actin with ... (D) Actin co-sedimentation assay verified the functional interaction between hhLIM and F -actin Purified F -actin was incubated with GST hhLIM or LIM domain-mutated hhLIM Cross-linked F -actin was...
- 11
- 347
- 0
microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice
... Under the Guidance of Professor Hyoung-Chun Kim Microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice A THESIS Submitted ... laminar distribution of A plaques in AD It is reasonable to speculate that the mEH activation around some plaques is at least partially derived from the combining stimulation of A and proinflammatory ... cerebral ventricle induces learning impairment and neuronal and morphological degeneration Japanese journal of pharmacology 1997;73(1):51-57 Nitta, A. ; Itoh, A. ; Hasegawa, T.; Nabeshima, T [beta] -Amyloid...
- 54
- 168
- 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
... caspase 1, WEHD-AMC; caspase 2, VDVADAMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5, WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; caspase 8, IETD-AMC; caspase 9, LEHD-AMC; caspase ... substrates and their inhibitors were purchased from Biomol Ac-DEVD-AMC is a substrate for caspases and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase and 10; Ac-LEHD-AMC ... the apoptosome, it is of similar native molecular mass to active caspase [38] Because KIPase cleaves a subset of caspase substrates, we queried whether KIPase is associated with apoptosis In all...
- 8
- 442
- 0
Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf
... uterine cervix, breast and urinary bladder is shown NANOGP8 was expressed in all of the human cancer tissues that were tested NANOGP8 was not expressed in human fibroblasts Nanog was expressed in ... that NANOGP8 was transcribed in all of the human cancer tissues tested (Table and Fig 2) as well as in several cancer cell lines In contrast, Nanog and NANOGP8 were not expressed in normal primarily ... (1) and E coli with NANOGP8 (2) and NANOGP8 in (A) OS732 and Nanog or NANOGP8 in MCF-7 and HepG2 using anti-Nanog antibody The lack of expression of both Nanog and NANOGP8 in human fibroblasts is...
- 8
- 495
- 0
Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc
... LJY430 LJY431 LJY432 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa Euroscarf [16] ATCC [15] This study ... the yeast deubiquitinating enzyme Ubp16, a metalloprotease belonging to the large family of deubiquitinating enzymes, mainly consisting of cysteine proteases [43] Another class of proteins are ... Intracellular synthesis of CCK-22 was decreased in a cym1D0 strain accompanied by an increased concentration of proCCK In contrast, the fraction of extracellular CCK-22 was increased compared to...
- 10
- 631
- 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... pcDNA3.1-GST -Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢ Another ... CCTCCAAAAAGCACACAGA-3¢ for St-182 and St-93/ -182, 5¢-AGAAATTATCATCTTTTCCAGTCCGAGA-3¢ for St-93 and St-93/-182, and 5¢-TGGTCTTGAACTCCT CGTGATCTGCCCA-3¢ for Lst-595 pcDNA3.1 -Nur77 expression plasmid...
- 14
- 397
- 0
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc
... first L-amino acid amidase whose primary sequence is revealed Acknowledgements We are grateful to S Iwamoto, R Kasahara and A Nakayama (Toyama Prefectural University) for their technical assistance ... ethylenediaminetetraacetic acid and o-phenanthroline and/or activated by divalent cations (Table 4) Comparison of the characteristics of LaaA with those of the other L-amino acid amidases suggests that LaaA is ... pSTB10 DNA sequence analysis An automatic plasmid isolation system PI-100 (Kurabo, Osaka, Japan) was used to prepare the double-stranded DNAs for sequencing The plasmid pSTB10 was used as a sequencing...
- 11
- 283
- 0
Báo cáo Y học: Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge pptx
... demonstrates antibacterial activity against E coli, and was dramatically induced in the liver following the challenge with fish pathogen, S iniae ACKNOWLEDGEMENTS This research was supported in part by ... (24 amino acids); (b) a prodomain (40 amino acids); and (c) a mature peptide (21 amino acids) (Fig 3) A canonical polyadenylation signal was found in the 3¢ UTR White bass hepcidin genomic DNA ... two additional analytical RP/HPLC purification steps as confirmed by capillary zone electrophoresis (data not shown) MALDI-TOF MS analysis of both fractions revealed the presence of an identical...
- 6
- 366
- 0
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt
... 4242 analysis This approach identified the Promyelocytic Leukemia Zinc Finger (PLZF) gene as a putative gene target of CUX1 PLZF was originally identified as a t(11;1 7) reciprocal chromosomal translocation ... Chip1up primer (5¢-aagctccagagggtctgcac-3 ) and Chip1dw primer (5¢-gaaaggcatcccgaacgcat-3 ); Chip2up primer (5¢-aaatgtcttgaccagccgtc-3 ) and Chip2dw primer (5¢-gaaacaaaggcctctcccag-3 ); Chip3up primer ... hB2MIC227dw, 5¢-tcaatgtcggatg gatgaaa-3¢ Acknowledgements We thank Dr Peter G Traber for the generous gift of the microarray data analysis that was originally performed at the Penn Microarray Facility...
- 13
- 359
- 0
Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc
... 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as ... is a crucial component of the protein phosphorylation cascade involved in CaS phosphorylation Characterization of the CaS mutant lines The mutant Arabidopsis lines with T-DNA insertion in the intron ... GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and nt115 (reverse: GGTTTAAUTAAGGATC CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG GAACTT), where the underlined sequence was included for regeneration of a USER cloning cassette The PCR...
- 11
- 446
- 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism by which ... dephosphorylation of phosphorylase a [16], that inactivation of GSK-3 in the absence of phosphorylase inactivation is a small component of the mechanism by which insulin stimulates hepatocyte glycogen synthesis ... inactivation of phosphorylase is an essential component of the mechanism by which insulin stimulates glycogen synthesis and it can account for the stimulation of glycogen synthesis by insulin over a...
- 9
- 381
- 0
Từ khóa: what is a proxy server in networkingwhat is a web service in cwhat is a web service in asp netwhat is a web service in asp net with examplewhat is a toucans habitat in the rainforestwhat is a gorillas habitat in the rainforestwhat is a jaguars habitat in the rainforestwhat is a 2d array in pythonwhat is a plant adaptation in the rainforestwhat is a 2d array in matlabwhat is a plant adaptation in the tropical rainforestwhat is a distributed system in javawhat is a character array in matlabwhat is a proxy server in computer termswhat is a proxy server in computerBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP