Development of a miniature low cost UAV helicopter autopilot platform and formation flight control of UAV teams 2
Development of a miniature low cost UAV helicopter autopilot platform and formation flight control of UAV teams 1
... Miniature UAV helicopter also has special attractiveness to the academic circle because of their smaller size, expendable lower cost, outstanding maneuverability, ease of uses, and wide range of capabilities ... name a few However, due to the highly dynamic behavior of helicopter, limited payload capability and lack of highly accurate sensors, miniature UAVs are stil...
Ngày tải lên: 11/09/2015, 09:59
Development of a miniature low cost UAV helicopter autopilot platform and formation flight control of UAV teams 2
... 22 0 23 0 24 0 25 0 190 20 0 21 0 22 0 23 0 24 0 25 0 190 20 0 21 0 22 0 23 0 24 0 25 0 190 20 0 21 0 22 0 Time: s 23 0 24 0 25 0 0.5 0.48 180 0 .24 col 21 0 0.54 0. 52 180 0. 52 δ 20 0 0 .23 0 .22 180 a Inputs of automatic ... 22 0 23 0 24 0 25 0 e UAV angular rates of automatic hovering flight test attitude output φ (deg) 10 −5 180 190 20 0 21 0 22 0...
Ngày tải lên: 11/09/2015, 09:59
The research is a sure-fire solution to apply on realistic condition due to its feasibility and low cost for a development of sustainable agriculture in Vietnam as the top aims of Sony Green competition
... disposed such as: Each brass basin has 10l (waste or pure water) with plants same size (35±2cm) Figure: Brass basin: waste concentration 100% with plants equation has brass basin: + Brass basin ... waste concentration 100% + Brass basin 2: waste concentration 50% + Brass basin 3: pure water equation has repeat sets - Stage of preparing for experiment: Ludwigia: (mark each of plant) + M...
Ngày tải lên: 15/01/2016, 16:17
Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf
... task, it was necessary to design and develop a novel technology that could directly interface a range of sensor elements and to provide a reliable and low cost method of capturing and storing the ... order to provide automatic interpretation of the output pulse train and to offer a direct readout in the numerical units desired In the case of PC-based...
Ngày tải lên: 22/06/2014, 01:20
Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc
... A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model Rachelle Buchbinder1,2,*,#, Roy Batterham3,*, ... develop a conceptual and measurement model of the overall burden of low back pain from the individual’s perspective using a...
Ngày tải lên: 12/08/2014, 18:20
Proceedings VCM 2012 38 the performance improvement of a low cost INSGPS integration
... inertial space Accelerometers, however may not separate the total acceleration of the vehicle, the acceleration with respect to inertial space, from that caused by the presence of a gravitational field ... take this information and use triangulation to calculate the user's exact location Essentially, the GPS receiver compares the time a signal was transmitted by a sate...
Ngày tải lên: 16/08/2015, 15:47
A comparative study of low cost biomaterials for the removal of chromium (VI III) from aqueous solutions
... A COMPARITIVE STUDY OF LOW- COST BIOMATERIALS FOR THE REMOVAL OF CHROMIUM (VI/ III) FROM AQUEOUS SOLUTIONS SYAM KUMAR PRABHAKARAN (B.Tech (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER ... studied for Sargassum, Ulva, used tea and coffee dusts The adsorption capacity of Ulva was lower compared to that of Sargassum The removal of...
Ngày tải lên: 15/09/2015, 22:51
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... history of diabetes and higher body mass indexes During the five years of follow-up, 1 02 (15 .2% ) patients in the normoglycaemia group and 66 (18.3%) patients in the hyperglycaemia group died There ... inclusion in the study We excluded 21 1 patients who refused to participate in the study, 20 3 patients due to terminal illness, and another 29...
Ngày tải lên: 25/10/2012, 10:02
Development of a method to measure consumer emotions associated with foods
... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...
Ngày tải lên: 03/04/2013, 21:07
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...
Ngày tải lên: 05/09/2013, 16:11
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... Risk Management Framework Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...
Ngày tải lên: 28/10/2013, 11:15
Tài liệu Creative economy as a development strategy a view of developing countires doc
... Ana Carla Fonseca Reis editor CREATIVE ECONOMY as a development strategy: a view of developing countries São Paulo 2008 Creative economy : as a development strategy : a view of developing countires ... Piedras Feria 142 The creative economy and the development possibilities in Argentina Facundo Solanas 160 Creative economy as a strategy...
Ngày tải lên: 14/02/2014, 08:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc
... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator Th...
Ngày tải lên: 05/03/2014, 14:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20