development of a spoken language

... a developing picture of the structure and mean- ing of a sentence. The CDG grammar has a weak generative capacity which is strictly greater than that of context-free grammars and has the added ... addition of the link nodes in the grammar. 2 Constraint Grammar Dependency Instead of using context-free grammars, we are using a natural language framework based on the *Parallel Architecture ... added advantage of benefiting significantly from a par- allel architecture [2]. PARSEC is our system based on the CDG formalism. To develop a syntactic and semantic analysis using this framework,...

Ngày tải lên: 23/03/2014, 20:20

Ngày tải lên: 18/06/2014, 22:20

... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy. Pizza and chocolate produced the strongest emotions based on Analysis of Variance. The terms active, adven- turous, affectionate, ... differentiating flavor variations of the same product. Data from this ballot were evaluated using Analysis of Variance (GLM procedure) in all future tests. Table 1 Consumer classification of emotions. ... techniques which are appropriate for the academic laboratory research might not be appropriate for commercial settings of consumer laboratories. Aca- demic laboratory research typically uses student...

Ngày tải lên: 03/04/2013, 21:07

... Management Framework - Introd uced Marine Pests Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are ... results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches  APEC and the MRCWG have a role in liaising with IMO, FAO, NACA to ... Introd uced Marine Pests Phase 1 – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management Framework  Conclusions,...

Ngày tải lên: 28/10/2013, 11:15

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vessel endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, paraformaldehyde;...

Ngày tải lên: 18/02/2014, 17:20

... spectroscopy has a very important role in studies of optical properties of materials. Our goal is to build a spectrometry system to measure weak optical signals such as Raman scattering and surface SH ... He-Ne laser instead of Ion Argon laser. The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser excitation. Acknowledgements: This work is supported by the Natural ... Key board, display board, Analog Input board, DSP Logic board and CPU and Power supply board. The DSP logic board takes a digital input from the A/ D converter on the Analog Input board and perform...

Ngày tải lên: 05/03/2014, 14:20

... (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); ... was performed on DNAse- treated RNA extracts. Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); ... expression vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG...

Ngày tải lên: 07/03/2014, 16:20

... interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any 3D objects in the form of digitized ... viewing and presenting the topographic data and the generated meshes. The package has been applied to the generation of 3D computational meshes used as the input of a computational fluid dynamics ... Nguyen Van Thang, Nguyen Tat Thang, Development of a software for the simulation of atmospheric flows over complex topography, Proceedings of the 2005 Annual National Conference on Fluid Mechanics,...

Ngày tải lên: 14/03/2014, 13:20

... ABA had a higher OH • level after ParA1 treatment. H 2 O, H 2 O pretreatment; H + ParA1, ParA1 infiltration after H 2 O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ... oligonucleotide prim- ers: 5¢-TGAATTC AATAATGTCTAACTTCCGCGCTCT- GTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢. For the suc- cessful protein expression, a yeast expression consensus sequence ... glutathione from Roche (Basel, Switzerland). Catalase, SOD, ascorbic acid and ABA were purchased from Sigma (St Louis, MO, USA). All other mentioned reagents were of analytical grade. Plant culture...

Ngày tải lên: 15/03/2014, 00:20

...

Ngày tải lên: 15/03/2014, 23:56

... Analytica Chimica Acta for the awarded bursary to present a paper at Euroanalysis X (Basel, Switzerland). The authors thank the crew of the R/V Belgica for their assistance during sampling, and ... seawater between an added metal chelating ligand (salicylal- doxime) and naturally occurring dissolved organic ligands have indicated that the establishment of an equilibrium may take more than ... higher salinity regions of estuaries and has been explained by an increase in major cation concentrations. Suspended particulate matter may consist of biological, organic and mineral phases [5] and...

Ngày tải lên: 15/03/2014, 23:56

... sonal communication]) or mathematical analysis of a body of language, often require matched stems. (So does stemming as part of an information-retrieval sys- tem, the specific application ... of Chicago, Department of Lin- guistics. variety of applications are considered in evaluating the theoretical and practical attributes of several previous algorithms. As a major part of its ... derivational and inflectional suffixes. Researchers in many areas of computational linguistics and information retrieval find this a desirable step, but for varying reasons. In auto- mated...

Ngày tải lên: 16/03/2014, 19:20

... Masayo Hosono 1, *, Miyako Kitamura 1 , Tatsuya Tsuda 2 , Kiyofumi Yamanishi 2 , Masatoshi Maki 1 and Kiyotaka Hitomi 1 1 Department of Applied Molecular Biosciences, Graduate School of Bioagricultural ... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Relative value 0 0.2 0.4 0.6 0.8 1 1.2 1.4 Fig. 4. Assessment of the contribution of each amino acid residue of K5 to substrate recognition. Alanine ... IL, USA). After termination of the catalytic reaction by addition of EDTA, the phage particles were precipitated in the presence of poly- ethyleneglycol and NaCl with salmon sperm DNA as a carrier....

Ngày tải lên: 23/03/2014, 06:20

... zinc- metalloproteinase from Serratia marcescens. Biochim Biophys Acta 955, 77–85. 6 Oda T, Kojima Y, Akaike T, Ijiri S, Molla A & Maeda H (1990) Inactivation of chemotactic activity of C 5a by the serratial ... 56-kilodalton protease. Infect Immun 58, 1269–1272. 7 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aerugi- nosa ... arrows, A1 A5 ) in the sequence of insulin chain A. (B) Change over time in the chromatographic peak area of cleavage fragments. Note that the amount of frag- ments A1 , A2 and A4 decreases on...

Ngày tải lên: 23/03/2014, 09:20

... that our approach to adapt existing annotated data to a dif- ferent language is fruitful. References David Ahn, Joris van Rantwijk, and Maarten de Ri- jke. 2007. A cascaded machine learning approach to ... processing of a new language: fast porting with minimal resources Francisco Costa and Ant ´ onio Branco Universidade de Lisboa Abstract We describe the semi-automatic adapta- tion of a TimeML annotated ... guarantee the quality of the annotation tags, translation of the markables and transposition of the annotations 671 in principle do not; d) the data obtained are com- parable to the original data...

Ngày tải lên: 23/03/2014, 16:20

Ngày tải lên: 24/03/2014, 01:21

Ngày tải lên: 30/03/2014, 20:20

Ngày tải lên: 31/03/2014, 08:20

Ngày tải lên: 06/05/2014, 08:55