Molecular and morphological characterization of caudal neural tube defects in embryos of diabetic swiss albino mice

Molecular and morphological characterization of caudal neural tube defects in embryos of diabetic swiss albino mice

Molecular and morphological characterization of caudal neural tube defects in embryos of diabetic swiss albino mice

... percentage of proliferating cells was found to be increased in the dorsal and ventral domains of the spinal neural tube of embryos from diabetic mice, indicating a defect in the precise timing of cell-cycle ... resulting in severe malformations of the neural tube Embryos from diabetic mice exhibit several forms of neural tube defects including non-...

Ngày tải lên: 11/09/2015, 09:04

178 297 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett...

Ngày tải lên: 21/02/2014, 00:20

9 487 0
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... terminus of the CRFR1 isoforms (Fig 1C) The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47.7/52 kDa), CRFR1e1 (10.8/ 15.1 kDa), CRFR1e2 (28.1/32.4 kDa), CRFR1f ... CRFR1 a, b, c and d isoforms differ in their ability to bind ligands and activate G proteins [10,16,25] CRFR1a is the most efficient in the stimulation of cAMP productio...

Ngày tải lên: 07/03/2014, 15:20

10 671 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

... this minireview is to summarize what is currently known about the molecular mechanisms of osmotic stress resistance, osmosensing and signal transduction in C elegans Osmosensing and signaling in ... process of interest, allows genes to be ordered into pathways, and can provide important and novel mechanistic insights into the molecular structure and functio...

Ngày tải lên: 30/03/2014, 03:20

8 495 1
Báo cáo y học: "Molecular and immunological characterization of allergens from the entomopathogenic fungus Beauveria bassiana" ppsx

Báo cáo y học: "Molecular and immunological characterization of allergens from the entomopathogenic fungus Beauveria bassiana" ppsx

... analysis of the available fungal aldehyde dehydrogenases failed to Allergy is a hypersensitive response of the immune system and fungi are important triggers of respiratory and other forms of allergies ... design of the study SWH participated in the design of the study and provided technical support for the project NOK conceived of the study, participated in...

Ngày tải lên: 13/08/2014, 13:22

11 278 0
Molecular and morphological phylogenetics of the faviidae (scleractinia) in singapore

Molecular and morphological phylogenetics of the faviidae (scleractinia) in singapore

... use of the COI barcode becomes a standard practice among coral scientists The increasing ease and falling cost of DNA sequencing has not only generated interest in the barcoding of the Scleractinia—reconstructions ... zooxanthellate species, i.e those containing symbiotic dinoflagellates, and these form the basis of coral reefs along the tropical and subtropical co...

Ngày tải lên: 26/11/2015, 12:47

152 368 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the heli...

Ngày tải lên: 18/02/2014, 18:20

14 620 0
Báo cáo khoa học: Sulfation of hydroxychlorobiphenyls Molecular cloning, expression, and functional characterization of zebrafish SULT1 sulfotransferases docx

Báo cáo khoa học: Sulfation of hydroxychlorobiphenyls Molecular cloning, expression, and functional characterization of zebrafish SULT1 sulfotransferases docx

... Detection of zebrafish SULT1 ST1 and ST2 mRNAs and (B) Western blot analysis of zebrafish SULT1 ST1 protein (A) Detection of zebrafish SULT1 ST1 and ST2 mRNAs in cultured zebrafish cells (lanes and 3) and ... sequence of zebrafish SULT1 ST1 displayed, respectively, 50%, 50%, and 49% identity to those of mouse SULT1C1, rat SULT1A1, and human SULT1A1 STs [22...

Ngày tải lên: 08/03/2014, 02:20

8 537 0
Báo cáo khoa học: "Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods" pdf

Báo cáo khoa học: "Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods" pdf

... M and Collins, M D Molecular taxonomic Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis 223 studies on Streptococcus uberis types I and ... profile using the restriction enzymes RsaI and AvaII RFLP analysis of the 16S rRNA gene had Identification and epidemiological characterization of Strept...

Ngày tải lên: 07/08/2014, 17:22

11 508 0
Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps

Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps

... light green-grey color [8] Four collections, namely CY1 (Chi-Yi-1), CY2 (Chi-Yi-2), CY3 (Chi-Yi-3) and HCn (Hsin-Chu-n) belong to B nivea var tenacissima and the other four, namely HCd (Hsin-Chu-d), ... (CY1) and B nivea var nivea (HCd) in the ratios of 9:1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8 and 1:9 Representative samples of the DNA ratio between B nivea var tenacissima (C...

Ngày tải lên: 13/08/2014, 14:20

9 352 0
Cellular and molecular control of skeleton formation in fish  insights from osteoblast ablation and functional characterization of lrp5 and SOst

Cellular and molecular control of skeleton formation in fish insights from osteoblast ablation and functional characterization of lrp5 and SOst

...  51   3.2 FUNCTIONAL CHARACTERIZATION OF LRP5 AND  ITS  PUTATIVE  INHIBITOR SOST  DURING   CRANIOFACIAL SKELETON FORMATION    53   3.2.1 Lrp5 and Sost  are  conserved ...  EXPRESSION OF LRP5 AND  ITS  PUTATIVE  INHIBITOR SOST  DURING  CRANIAL   SKELETON  DEVELOPMENT IN  ZEBRAFISH    84   4.3  A  ROLE  FOR LRP5 AND SOST IN  MORPHOGENESIS OF  THE ...  Complementary and  ...

Ngày tải lên: 10/09/2015, 08:43

111 368 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 To...

Ngày tải lên: 18/02/2014, 17:20

12 616 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
w