Identification of PARP1 as a transcriptional regulator of HBV replication
... Acetylation Inhibition Activation PARP1 Enzymes that result in PARP1 modification PP5 P PARP1 PARP2 ERK2 CaMK PARP3 PARG p300 SUMO3 Casp3 /CBP SUMO1 Casp7 R P PARP1 R R R Ac PARP1 PARP1 PARP1 Su PARP1 ... by activated PARP1, as PAR can be added onto PARP1 by other members of the PARP family such as the DNA repair enzyme PARP2 PARP1 can also exert its effects as an i...
Ngày tải lên: 10/09/2015, 15:50
... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... Na -palmitoylation of Gas is regulated also remains unclear However, we assume that mammalian Gup1 competes with Skn for Shh to prevent palmitoylation rather than catalyzing...
Ngày tải lên: 18/02/2014, 16:20
... overproliferation can alter the balance between neuronal populations, leading to mental disorders and neuropathologies MNB ⁄ DYRK 1A has also been implicated in various aspects of late neuronal differentiation ... Bescond M & Rahmani Z (2005) Dual-specificity tyrosine-phosphorylated and regulated kinase 1A (DYRK 1A) interacts with the phytanoyl-CoA alphahydroxylase associated protei...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... UCSC annotated sequences (UCSC Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other ... pre-miR-30d, RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacture...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " siRNA screen of the human signaling proteome identifies the PtdIns(3,4,5)P3-mTOR signaling pathway as a primary regulator of transferrin uptak" docx
... signaling pathway (b) Quantification of the effects of different siRNAs targeting the PtdIns(3,4,5)P3-mTOR pathway and rapamycin (RAPA) on transferrin uptake Means ± standard error of the mean ... uptake is under the control of the PtdIns(3,4,5)P3-mTOR signaling pathway Identification of the mTOR pathway as primary signaling module controlling tr...
Ngày tải lên: 14/08/2014, 07:22
Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot
... example, ATPase /helicase activity is found associated with TFIIH and chromatin remodeling complexes and plays crucial roles in transcriptional initiation and preinitiation The ATPase /helicase activity ... recombinant TNF -a was purchased from Roche interference RNA (siRNA) 5¢-GCAUAAAACUUCUGC GUCU-3¢ was targeted to the RHA portion from 2408 to 2426 Control siRNA 5¢-AUUCUAUCAC...
Ngày tải lên: 30/03/2014, 15:20
Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx
... (5’-CATAATGACTGGGCAAACTCATCTACCACTGCTCAA-3’) L30/43 -AS 2AY -AS1 01 (5’-TTGAGCAGTGGTAGATGAGTTTGCCCAGTCATTATG-3’) (5’-CCGCTCGAGTTACTGATCATCCAACCACAGAAG-3’) 2A- AS3 01 (5’-GCTCTAGACTGATCATCCAACCACAGAAG-3’) CoxB2AY-S ... 2AY-11 0AS (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) 2AY-13 0AS VP1 / 2A- S (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) (5’-CCATCGATATGATGGGTACGTTC-3’) 2A- S10 (5’-GGAATTCATGGGGAAATTTGGACA...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to proteins ... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ m...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... (Rheumaklinik Aachen, Aachen, Germany), Prof Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany) To assess further the assay specificity, we analyzed ... studies are necessary to screen known autoantigens containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti -SmD3 peptide (SMP) assay (a)...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Identification of kinectin as a novel Behçet''''s disease autoantigen" doc
... cells, and antibody to endothelial cell antigen (AECA) has been reported Reports on the prevalence of AECA have varied largely and alpha-enolase was reported as one of the putative target antigens ... kinectin by screening an aplastic anemia patient for candidate antigens using a Clontech human fetal liver cDNA expression library and it was concluded that seven out of 18 aplastic...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Identification of citrullinated α-enolase as a candidate autoantigen in rheumatoid arthritis" doc
... Sugaya M, Hanagiri T, Yasumoto K: [Tumor marker in primary lung cancer] J UOEH 2004, 26:473-479 38 Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida ... citrullinated α-enolase by immunoblotting This suggests that citrullinated α-enolase is at least as immunodominant as citrullinated filaggrin or citrullinated vimentin, beca...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx
... as: Krishnan et al.: Identification of Glyceraldehyde-3phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells ... Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal actions of paras...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Dermoscopy as a technique for the early identification of foot melanoma" pot
... skin A videomicroscopic analysis Arch Dermatol 1998, 134:563-568 Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa S, Tsuchida T, Kawabata Y, Tamaki K: Significance of ... clinical diagnosis Arch Dermatol 1995, 131:298-304 Saida T, Yoshida N, Ikegawa S, Ishihara K, Nakajima T: Clinical guidelines for the early detection of plantar malignant melanoma J...
Ngày tải lên: 10/08/2014, 21:23
báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx
... important for ATP binding, has no kinase activity [13] To examine whether purified GST-AtHaspin has kinase activity, an in vitro kinase assay was performed using purified GST-AtHaspin and GST-AtHaspin ... Dlk/ZIP kinase orthologues, and thus, AtHaspin has an additional role as a H3 Thr11 kinase in A thaliana Phosphorylation of histone H3 at Thr3 and Thr11 Mitotic...
Ngày tải lên: 11/08/2014, 11:22