0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Relapse prediction in childhood acute lymphoblastic leukemia by time series gene expression profiling

Relapse prediction in childhood acute lymphoblastic leukemia by time series gene expression profiling

Relapse prediction in childhood acute lymphoblastic leukemia by time series gene expression profiling

... RELAPSE PREDICTION IN CHILDHOOD ACUTE LYMPHOBLASTIC LEUKEMIA BY TIME- SERIES GENE EXPRESSION PROFILING DIFENG DONG (B COMP., FUDAN UNIVERSITY) A THESIS ... modeling and relapse prediction in childhood ALL  We generate the first time- series GEPs in leukemia The data are collected at the time of diagnosis, and days, 15 days and 33 days after the initial ... 2.2 13 Gene Expression Profiling Gene expression profiling (GEP) refers to the microarray technology, invented in the mid 1990s, that allows monitoring the activity of tens of thousands of genes...
  • 141
  • 202
  • 0
Báo cáo y học:

Báo cáo y học: " Challenges in implementing individualized medicine illustrated by antimetabolite therapy of childhood acute lymphoblastic leukemia" ppt

... determined by the therapy- disease interaction, i.e the drug resistance of the invading microorganism Accordingly, benefits of individualized medicine are expected to be modest and mostly financial, ... chemotherapy Curr Opin Pediatr 2007, 19:15-22 doi:10.1186/1559-0275-8-8 Cite this article as: Nersting et al.: Challenges in implementing individualized medicine illustrated by antimetabolite therapy ... characteristics of the leukemic clone (e.g lineage, cytogenetics, and tumor burden) In recent years this has been refined by adding monitoring of the early response to induction chemotherapy (i.e monitoring...
  • 12
  • 285
  • 0
báo cáo hóa học:

báo cáo hóa học: " Health-related quality of life assessment in Indonesian childhood acute lymphoblastic leukemia" potx

... ALL: acute lymphoblastic leukemia; HRQOL: healthrelated quality of life; PedsQL™: the Pediatric Quality of Life Inventory™ Competing interests The authors declare that they have no competing interests ... Y: Measuring health-related quality of life in Greek children: psychometric properties of the Greek version of the Pediatric Quality of Life Inventory(TM) 4.0 Generic Core Scales Qual Life Res ... survival: quality of life and follow-up after childhood cancer J Pediatr Psychol 2007, 32:1140-50 Varni JW, Burwinkle TM, Lane MM: Health-related quality of life measurement in pediatric clinical...
  • 8
  • 415
  • 0
báo cáo hóa học:

báo cáo hóa học:" Health-related quality of life assessment in Indonesian childhood acute lymphoblastic leukemia" docx

... ALL: acute lymphoblastic leukemia; HRQOL: healthrelated quality of life; PedsQL™: the Pediatric Quality of Life Inventory™ Competing interests The authors declare that they have no competing interests ... Y: Measuring health-related quality of life in Greek children: psychometric properties of the Greek version of the Pediatric Quality of Life Inventory(TM) 4.0 Generic Core Scales Qual Life Res ... survival: quality of life and follow-up after childhood cancer J Pediatr Psychol 2007, 32:1140-50 Varni JW, Burwinkle TM, Lane MM: Health-related quality of life measurement in pediatric clinical...
  • 8
  • 574
  • 0
báo cáo khoa học:

báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx

... was to determine the polymorphisms of leptin and leptin receptor genes and plasma levels of leptin and leptin soluble receptors in survivors of childhood ALL The study assessed the influence of ... arcuate nucleus In some cells of hypothalamus, leptin and insulin activate both JAK-STAT and PI3K signaling pathways Additionally, both enzymes terminating leptin and insulin function – SOCS3 and ... Genotyping method used (restriction enzyme) Leptin gene - 18G > A tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc...
  • 9
  • 356
  • 0
báo cáo khoa học:

báo cáo khoa học: "The frequency of NPM1 mutations in childhood acute myeloid leukemia" doc

... [20] In the current study, no NPM1 mutations were detected in cases with secondary AML following MDS, which is in line with previous studies associating absence or low rates of NPM1 mutations in ... Frequency of FLT3 mutations in childhood acute lymphoblastic leukemia Med Oncol 2009, 26:460-462 Thiede C, Creutzig E, Reinhardt D, Ehninger G, Creutzig U: Different types of NPM1 mutations in ... [10,21] Mutations of the NPM1 gene were present in 8% of AML cases in this study This is in agreement with previous reports on childhood AML [1,4,17] More than 40 different types of NPM1 mutations...
  • 5
  • 319
  • 0
báo cáo hóa học:

báo cáo hóa học: " Impaired sleep affects quality of life in children during maintenance treatment for acute lymphoblastic leukemia: an exploratory study" pdf

... a decrease in mortality and an increased attention for the burden of treatment for both the patient and family QoL is impaired in children during cancer treatment, and the results of this study ... children during maintenance treatment for acute lymphoblastic leukemia: an exploratory study Health and Quality of Life Outcomes 2011 9:25 Submit your next manuscript to BioMed Central and take ... confirm these findings and provide more detailed information on the relationship between sleep and QoL, and on factors affecting sleep in pediatric ALL and in children with cancer in general Abbreviations...
  • 7
  • 509
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Mitochondrial DNA alterations of peripheral lymphocytes in acute lymphoblastic leukemia patients undergoing total body irradiation therapy" ppt

... DNA alterations of peripheral lymphocytes in acute lymphoblastic leukemia patients undergoing total body irradiation therapy Quan Wen1, Yide Hu1§, Fuyun Ji2, Guisheng Qian2 Third Department of ... leukemia (ALL) patients undergoging total body irradiation (TBI) precondionting as human beings in vivo irradiation model The advantage of using this model lies in full view of in vivo microenvironment, ... are key indicators of irradiation- induced damage The relationship between total body irradiation (TBI) treatment and mtDNA alterations in vivo, however, has not been postulated yet The aim of this...
  • 25
  • 227
  • 0
báo cáo khoa học:

báo cáo khoa học: "Persistence of TEL-AML1 fusion gene as minimal residual disease has no additive prognostic value in CD 10 positive B-acute lymphoblastic leukemia: a FISH study" doc

... disease TEL-AML1 fusion as a minimal residual disease Kaplan-Meier curve for the persistence of TEL-AML1 fusion as a minimal residual disease (MRD) as a predictor of overall cumulative survival after ... Satake N, Sakashita A, Kobayashi H, Maseki N, Sakurai M, Kaneko Yl: Minimal residual disease with TEL-AML1 fusion transcript in childhood acute lymphoblastic leukemia with t(12;21) Br J Haematol ... It was measured in newly diagnosed cases (Table 1) and it was positive in 30/80 (37.5%) determining its frequency in B-lineage ALL positive for CD 10 and CD 19 The mean percent of TEL-AML1 fusion...
  • 7
  • 225
  • 0
báo cáo khoa học:

báo cáo khoa học: "SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemia-derived cell lines" ppsx

... leukemia/lymphoma cell lines of T-, B- and myeloid cell origin to detect SET-NUP214 positive examples A T-ALL cell line LOUCY (1/43 T cell lines tested) and an AML cell line MEGAL (1/53 myeloid cell lines ... del(9)(q34.11q34.13) in cell lines LOUCY and Deletion del(9)(q34.11q34.13) in cell lines LOUCY and MEGAL Sequencing identified SET exon 7/NUP214 exon 18 fusion mRNA in both cell lines Genomic sequencing located ... breakpoint to regions downstream of the stop codon of SET and to intron 17/18 of NUP214 in both cell lines AC-3' For the determination of genomic SET and NUP214 breakpoints in cell lines LOUCY and...
  • 5
  • 199
  • 0
báo cáo khoa học:

báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc

... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern of the BCL11B gene and four of its related genes (TNFSF10, ... electrophoresis analysis The size of the PCR products of the b2M gene used for the BCL11B reference is 332 bp (line 1, 2) and that used for the four genes of interest is 145 bp (line 4-11) Line 3: DNA ladder...
  • 7
  • 410
  • 0
Báo cáo y học:

Báo cáo y học: "Acute lymphoblastic leukemia subsequent to temozolomide use in a 26-year-old man: a case report." doc

... transforming in undifferentiated leukemia [3,5] and one report of Ph negative T-ALL in a patient receiving treatment [6] TMZ is an oral alkylating agent that is now known to be active against a ... variety of CNS neoplasms After oral absorption, it spontaneously hydrolyzes to methyltriazen-1-yl imidazole-4-carboxamide (MTIC) MTIC degrades to a highly reactive cation that methylates guanines ... Eisenhauer E, Mirimanoff RO, European Organisation for Research and Treatment of Cancer Brain Tumor and Radiotherapy Groups; National Cancer Institute of Canada Clinical Trials Group: Radiotherapy...
  • 3
  • 277
  • 0
Báo cáo y học:

Báo cáo y học: "Acute lymphoblastic leukemia subsequent to temozolomide use in a 26-year-old man: a case report" potx

... transforming in undifferentiated leukemia [3,5] and one report of Ph negative T-ALL in a patient receiving treatment [6] TMZ is an oral alkylating agent that is now known to be active against a ... variety of CNS neoplasms After oral absorption, it spontaneously hydrolyzes to methyltriazen-1-yl imidazole-4-carboxamide (MTIC) MTIC degrades to a highly reactive cation that methylates guanines ... Eisenhauer E, Mirimanoff RO, European Organisation for Research and Treatment of Cancer Brain Tumor and Radiotherapy Groups; National Cancer Institute of Canada Clinical Trials Group: Radiotherapy...
  • 3
  • 267
  • 0
Báo cáo y học:

Báo cáo y học: "The impact of therapy for childhood acute lymphoblastic leukaemia on intelligence quotients; results of the risk-stratified randomized central nervous system treatment trial MRC UKALL XI" ppsx

... Halsey et al.: The impact of therapy for childhood acute lymphoblastic leukaemia on intelligence quotients; results of the risk-stratified randomized central nervous system treatment trial MRC UKALL ... cranial radiotherapy of children receiving intensified chemotherapy for acute lymphoblastic leukaemia: results of the risk-stratified randomized central nervous system treatment trial MRC UKALL XI ... 34 45 35 139 116 134 104 month only 92 133 23 28 35 57 94 15 16 34 29 year only 37 40 21 10 month and year only 30 39 17 17 month and year only 13 0 year and year only 56 116 12 15 43 46 All tests...
  • 12
  • 354
  • 0

Xem thêm

Từ khóa: antipurines in childhood acute lymphoblastic leukemiachildhood acute lymphoblastic leukemiaprognostic factors in adult acute lymphoblastic leukemia allmonoclonal antibodies in paediatric acute lymphoblastic leukemiav d j recombination in precursor b cell acute lymphoblastic leukemiabmt in philadelphia positive acute lymphoblastic leukemia ph alla perspective on the treatment of acute lymphoblastic leukemia in adultsminimal residual disease in acute lymphoblastic leukemiatreatment of acute lymphoblastic leukemia in middle age and older adultstreatment of acute lymphoblastic leukemia in young adultshematopoietic stem cell transplantation in philadelphia positive acute lymphoblastic leukemiaunique subtypes in acute lymphoblastic leukemiaacute lymphoblastic leukemia in adultsacute lymphoblastic leukemia in childrenidentifying targets for new therapies in children with acute lymphoblastic leukemiachuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM