Promoting angiogenesis in bioartificial grafts towards enhanced myocardial restoration
... Vascularization In Myocardial Grafts In Vivo Tissue Engineering and Regenerative Medicine 2009; 6(12): S273 International Conference Presentations Martinez EC, Wang J, Lilyanna S, Ling LH, Gan SU, Singh ... remodeling and contractility [Hilfiker-Kleiner, 2006] 1.2.5 Angiogenesis in the Ischemic Heart Angiogenesis is defined as the sprouting of blood vessels from pre-existing cap...
Ngày tải lên: 10/09/2015, 15:49
... of cyclin E and cyclin E ⁄ CDK2 in the choroid of alcohol- fed rats at 10 weeks, we did not see a change in the expression of p27Kip, a cyclin kinase inhibitor Thus, the increased expression of ... increased FAEES activity resulted in increased production and accumulation of ethyl esters in the choroid of alcoholfed rats, with the size of the increase related to the n...
Ngày tải lên: 30/03/2014, 11:20
... Algorithms in Search, Optimization & Machine Learning AddisonWesley, Boston, 1989 Zhang Z., Agarwal R.K Numerical Simulation and Optimization of CO2 Sequestration in Saline Aquifers for Vertical and ... [4] Zhang Z., Agarwal R.K Numerical Simulation and Optimization of CO2 Sequestration in Saline Aquifers in: Proceedings of 10th Annual Confer...
Ngày tải lên: 05/09/2013, 16:10
Tài liệu PROMOTING HEALTH IN SCHOOLS ROM EVIDENCE TO ACTION ppt
... The Achieving Health Promoting Schools: Guidelines for Promoting Health in Schools document provides details about what works and issues that have the potential to inhibit health promotion development ... 17 – McQueen, D V (2007) Evidence and theory continuing debates on evidence and effectiveness” “Achieving Health Promoting Schools: Guidelines for Promoting Healt...
Ngày tải lên: 14/02/2014, 21:20
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf
... from the pia mater invade the brain and extend toward the ventricles [4] Like other vascular networks, brain vessels undergo formation, stabilization, branching, pruning and specialization In brief, ... transports water bidirectionally between the blood and the brain Astrocytes secrete water into the perivascular space via AQP4, thereafter maintaining water homeostas...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: therapeutic aspects of vascular endothelial growth factor doc
... 4641 Therapeutic aspects of VEGF in brain diseases M Shibuya which to rapidly and efficiently suppress vascular leaks during the clinical course of brain diseases or during the treatment of brain ... Shibuya Therapeutic aspects of VEGF in brain diseases [3] The BBB mainly consists of a strong interaction between vascular endothelial cells and astrocytes,...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke docx
... recovery after ischemia in other organs So it is reasonable to expect that similar processes would occur in the brain after stroke In penumbral regions, increased Neurovascular responses in stroke ... mediators mediate neurovascular injury by disrupting the BBB and ⁄ or brain cell death In the delayed phase, they may support neurovascular remodeling by enhanc...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt
... peptide-containing proteins in renal cell carcinoma tissues is associated with a decrease in tumor growth and angiogenesis Clin Cancer Res 9, 17 34 1 740 19 Lawler J (2002) Thrombospondin-1 as an ... and inhibitors of angiogenesis in FEBS Journal 2 74 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6375 Thrombospondin-1 loss in renal cancer 35...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Metabolomics, modelling and machine learning in systems biology – towards an understanding of the languages of cells potx
... hypothesis-driven science in the postgenomic era Bioessays 26, 99105 17 Kell DB (2005) Metabolomics, machine learning and modelling: towards an understanding of the language of cells Biochem Soc Trans 33, 520524 ... models and reality on one hand and between changes in the model that are invoked and its subsequent dynamic behaviour, leading to an unders...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCC...
Ngày tải lên: 07/03/2014, 12:20
Responsibility of Applicants for Promoting Objectivity in Research for which Public Health Service Funding is Sought and Responsible Prospective Contractors pot
... list of examples of different types of PHS funding mechanisms to which the definition applies As revised, the definition under 42 CFR 50.603 includes any activity for which research funding is ... 93.282—Mental Health National Research Service Awards for Research Training 93.286—Discovery and Applied Research for Technological Innovations to Improve Human...
Ngày tải lên: 15/03/2014, 19:20
Models of Health Promoting Schools in Europe doc
... of health promoting schools Schools interested in joining the network must make the following eight steps: Becoming familiar with the method of the health promoting school project described in ... from schools participating in the network of the health promoting school project 18 Health - essentials of maintaining a life of high - quality (individual / commun...
Ngày tải lên: 22/03/2014, 15:20
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt
... activity improve vascular density in a model of acute myocardial infarction Journal of Translational Medicine 2010 8:24 Submit your next manuscript to BioMed Central and take full advantage of: • ... nucleated human cells in a total of 150 individual sections obtained from the basal, medial, and apical portions of the hearts Human engraftment Page of 13 i...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Analysis of machine perfusion benefits in kidney grafts: a preclinical study" doc
... (Roche Diagnostics, Meylan, France) and AAP determination was measured using storage method and colorimetric assay NAG and AAP activity (U/L) was expressed as a ratio with urinary creatinine (mmol/L) ... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D: Weight increase during machine perfusion may be an indicator of organ and in particular, vascular damage Ann Transplant 2004...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Analysis of machine perfusion benefits in kidney grafts: a preclinical study" pdf
... (Roche Diagnostics, Meylan, France) and AAP determination was measured using storage method and colorimetric assay NAG and AAP activity (U/L) was expressed as a ratio with urinary creatinine (mmol/L) ... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D: Weight increase during machine perfusion may be an indicator of organ and in particular, vascular damage Ann Transplant 2004...
Ngày tải lên: 20/06/2014, 03:20