Genetic analysis of the role of ARP2 3 complex in border cell migration in drosophila melanogaster

... polyproline sequences and interacts with profilin (Chang et al 1997) Since profilin binds to actin monomer, FH1 domains can bind the profilin-G-actin 13 Arp2/ 3 complex in border cell migration ... actin assembly In Drosophila, the Arp2/ 3 complex functions in actin dynamics together with SCAR/WAVE and WASP proteins The Drosophila Arp2/ 3 complex and SCAR/...

Ngày tải lên: 10/09/2015, 15:48

... magenta, and cyan, respectively Although krimp was identified as a highly expressed mRNA in the GSCs from the microarray analysis, immunostaining of KRIMP indicates a wide expression in germline ... melanogaster germline cells (a) KRIMP localises to the perinuclear regions of the germline cells in the Drosophila ovary Ovaries were immunostained with anti-KRI...

Ngày tải lên: 14/09/2015, 08:25

... of processing body (P-body) that are known to participate in mRNA degradation and translational silencing, Decapping Protein 1a (DCP 1a) and Glycine-tryptophan protein of 18 2kDa (GW182), are also ... et al., 2005b), and that the C elegans homologue of GW182, Acyl-CoA carboxylase insensitive (AIN -1) , interacts with a putative AGO family protein, Asparagine-linked glycosylation...

Ngày tải lên: 14/09/2015, 08:25

... gtcccacaccaacggcggag taatacgactcactataggg aattaaccctcactaaaggg catacgatttaggtgacactatatag cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta atgtcgaagatcggaattaac ttagtccttgctctgcatatactt ... caggattgataagaatgcaggacaaaa ttgcaatatgttaatgttaccagtccatg actttgctggtggaggtacggagacagagtaaattctgt t cataatactccacgcgcaaa cgtcttttggcttcttctcc attgccctcaaatcaagcag gtggacggaggagaagacaa tcattgacgatacc...

Ngày tải lên: 14/09/2015, 08:25

... vas, aub, cuff, and mael mutants In all of the examined mutants except mael, KRIMP perinuclear localisation was affected, while the localisation of AGO3 and MAEL appeared to depend on KRIMP, as ... It was also noticeable that VAS localisation depends partially on proper AUB localisation Although VAS foci were apparent in aub mutant, cytoplasmic VAS was visibly more abundant than...

Ngày tải lên: 14/09/2015, 08:25

... the nuage site Indeed, a recent study has suggested that TUD aids in the association of piRNAs with AUB and AGO3 in an arginine methylationdependent manner (Nishida et al., 2009) The nuage components, ... silencing of LINEs/nonLTRs among the examined nuage components therefore implies a common role in maintaining the silenced state of the heterochromatic retroeleme...

Ngày tải lên: 14/09/2015, 08:25

... that consist of nuage cytoplasmic foci docking partially around the mRNA degradation components Overlapping nuage/P-body foci are expressed as percentages of the total number of overlapping and ... non-overlapping P-body foci The range of overlaps (complete or partial) appears to be independent of the foci sizes and nuage/P-body pairs (b) Immunostaining of overlapping cyto...

Ngày tải lên: 14/09/2015, 08:25

... that deadenylation is unaffected in at least one of the piRNA pathway mutant aub Figure 3.3 .7 Deadenylation is unaffected in aub mutant LM-PAT assay of cycB In the piRNA pathway mutant aub, deadenylation ... deadenylation appears unaffected since the poly (A) tail length is comparable to that of the control In contrast, deadenylation is impaired in the deadenylase...

Ngày tải lên: 14/09/2015, 08:25

... unaffected in the mRNA degradation mutants PAGE-northern analyses of piRNA production in the mRNA degradation mutants The level of piRNA production is unaffected in the mRNA degradation mutants ... 3’-UTR, and poly (A) All examined regions are derepressed in dcp1 and ski3 mutants (b) Quantitative RACE-PAT and RT-PCR of HeT -A mRNA, normalised against act5C, in dcp1 an...

Ngày tải lên: 14/09/2015, 08:25

... overlapped with the tER and endosomal markers (Figure 3.4.1) This is consistent with the observation by Lee et al (20 09) that AGO1 and AGO2 are associated with membranes in the cytoplasm in RNAi-defective ... tER/endosomal markers TER94, CD63, LAMP2, and ARF6 (green) In the wild-type ovary, KRIMP, PCM, and TER94/CD63/LAMP2/ARF6 overlap In the piRNA pathway mutants spn-E and...

Ngày tải lên: 14/09/2015, 08:25

... eye and salivary glands of D melanogaster (Pal-Bhadra et al., 2004) A preliminary finding in our laboratory has indicated the presence of VAS, KRIMP, and MAEL transcripts in the wild-type adult ... Cavalli, and V .A Gvozdev 2004 Dissection of a natural RNA silencing process in the Drosophila melanogaster germline Mol Cell Biol a2 4:6742-6750 Aravin, A. A., M L...

Ngày tải lên: 14/09/2015, 08:25

... catalytic activity of a subunit toward calmodulin and for the activation by polybasic compounds The examination of amino-acid alignment in the acidic region of three Drosophila CK2 regulatory subunits ... coimmunoprecipitated with CK2 a subunit in Drosophila testes extracts Fig Analysis of oligomerization status of the CK 2a and CK2btes proteins by gel fi...

Ngày tải lên: 21/02/2014, 15:20

... resembled type clusters in being large and having no functional similarity This may simply reflect an inability to define functional co-ordination, but for want of evidence we shall consider the clusters ... breakpoints is influenced by the fragility of certain types of sequence (see, for example, [51,52]) We start by examining the role of recombination and IGD in mo...

Ngày tải lên: 09/08/2014, 22:24

... architecture of tolerance to acrolein in Drosophila melanogaster Genet Sed Evol (in press) Dickinson W.J (1970) The genetics of aldehyde oxidase in Drosophila melanogaster Genetics 66, 487-496 Draminsky ... Changes in the behaviour of individual members of a Drosophila population maintained by random mating Heredity 33, 89-93 Barros A.R (1987) Algunos aspectos de la r...

Ngày tải lên: 14/08/2014, 20:20

... the inhibition is incorporated into neural function Use of a heterologous system expessing channels of interest (such as the Xenopus oocyte) provides an efficient starting point for the study of ... provides a means to study the activity of ion channels directly as it functions This dissertation contains the study of potassium channels in identified motorneurons in th...

Ngày tải lên: 13/11/2014, 10:51