Identification and functional validation of caldesmon as a potential gastric cancer metastasis associated protein

Identification and functional validation of caldesmon as a potential gastric cancer metastasis associated protein

Identification and functional validation of caldesmon as a potential gastric cancer metastasis associated protein

... Distant metastasis Presence of distant metastasis cannot be assessed No distant metastasis Distant metastasis Table 1.1 TNM staging classification of gastric cancer 11 1.2.2 Metastasis Is a Multi-Step ... Hou Q, Tan HT, Lim KH, Lim TK, Khoo A, Tan IB, Yeoh KG, Chung MC Identification and Functional Validation of Caldesmon as a Potential Gastric Cancer...
Ngày tải lên : 10/09/2015, 09:09
  • 142
  • 254
  • 0
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... Therefore the redox state of the cysteinyl residues of the various forms of apoFNR – ‘aerobic’ and ‘anaerobic’ apoFNR, and apoFNR obtained by air-induced inactiva...
Ngày tải lên : 23/03/2014, 15:20
  • 10
  • 477
  • 0
Báo cáo y học: "Identification and functional characterization of cis-regulatory elements in the apicomplexan parasite Toxoplasma gond" pptx

Báo cáo y học: "Identification and functional characterization of cis-regulatory elements in the apicomplexan parasite Toxoplasma gond" pptx

... regulatory questions in the actively multiplying tachyzoite, as any given population of cells in culture consists of parasites at different points of their cell cycle Our study reports the presence of ... a majority of the bases in each motif were substituted by base-specific transversions, thus destroying the original sequence of the candidate motif but maintainin...
Ngày tải lên : 14/08/2014, 21:20
  • 15
  • 312
  • 0
Biochemical identification and functional characterization of microrna target interactions in growth control and cancer transformation

Biochemical identification and functional characterization of microrna target interactions in growth control and cancer transformation

... characterizations of miRNA -target interactions involved in growth control and cancer transformation I used biochemical immunoprecipitation against Drosophila Ago1 (Ago1-IP) to isolate and purify Ago1/miRNA/mRNA ... protein (green) and GW182 (blue) GW182 proteins contain an N-terminal AGO-binding domain, which provides multiple binding sites for Argonaute proteins and...
Ngày tải lên : 09/09/2015, 10:17
  • 141
  • 474
  • 0
Characterisation of CD137 as a neoantigen on cancer cells

Characterisation of CD137 as a neoantigen on cancer cells

... as well as signaling via CD137 into the cancer cells may potentially be responsible for conferring a survival advantage upon cancer cells As a result, increased T cell apoptosis (Schwarz et al ... it was hypothesized that cancer cells may express CD137 as a neo-antigen to gain certain survival advantages Due to the bidirectional nature of CD137: CD137L signali...
Ngày tải lên : 03/10/2015, 11:37
  • 106
  • 208
  • 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to proteins ... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ m...
Ngày tải lên : 30/03/2014, 15:20
  • 17
  • 440
  • 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

... 3.2 Characterization of flavonoids on PPAR and PPAR activity 103 3.3 Characterization of flavonoids and PPAR ligands on a natural PPAR V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... their clinical application especially in patients with heart failure (Arakawa et al 2004; Rangwala and Lazar 2004; Staels 2005) 1.3.2 Dual PPAR /PPAR ligands...
Ngày tải lên : 12/09/2015, 08:20
  • 263
  • 267
  • 0
Group 2 allergens from dust mite  epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

... allergen from Dermatophagoides farinae: a paralogue of Der f 2? 75 4.1 Introduction 75 4 .2 Identification, isolation and characterization of Der f 22 76 4.3 Genomic organization of Der f 22 and Der f ... antibodies raised against Der f 22 and Der f 2, and immunolocalization on D farinae sections 93 Figure 4. 12 Concentration of Der...
Ngày tải lên : 15/09/2015, 17:09
  • 235
  • 904
  • 0
Identification of plant as a novel and alternative host model for burkholderia pseudomallei

Identification of plant as a novel and alternative host model for burkholderia pseudomallei

... Pseudomonas syringae and R solanacearum have been elucidated using Arabidopsis as a plant model (Quirino and Bent, 2003) 3.2 Materials and Methods 3.2.1 Plant Materials 3.2.1.1 Tomato and Arabidopsis ... and can be isolated from rice paddy fields in endemic areas such as Thailand Dharakul and Songsivilai first raised the question of a relationship between B pseudo...
Ngày tải lên : 09/10/2015, 10:49
  • 119
  • 420
  • 0
Identification and characterization of IFI30 as a glioblastoma specific promoter for glioma gene therapy

Identification and characterization of IFI30 as a glioblastoma specific promoter for glioma gene therapy

... astrocytoma grades I, II [astrocytoma], III [anaplastic astrocytoma] and IV [glioblastoma or GM]), oligodendrogliomas, ependymomas and mixed gliomas Gliomas constitute 77% of the primary malignant brain ... the characterization of a glioblastoma specific promoter This study deals with the identification, isolation and characterization of a glioblastoma specific...
Ngày tải lên : 22/10/2015, 21:20
  • 92
  • 404
  • 0
A contrastive analysis of encouraging as a speech act in english and vietnamese

A contrastive analysis of encouraging as a speech act in english and vietnamese

... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese as a speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The ... Objectives of The Study This research is intended to deal with the followings: - To find out the common strategies of encouraging in Vietnamese as...
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...
Ngày tải lên : 18/02/2014, 16:20
  • 12
  • 656
  • 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig ... CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and TRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢), respectively...
Ngày tải lên : 21/02/2014, 03:20
  • 11
  • 506
  • 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

... article as: Tsuruta et al.: Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined ... studies and to begin to standardize the clinical dosing of therapeutic ultrasound when used as a male contraceptive Sinc...
Ngày tải lên : 05/03/2014, 17:20
  • 15
  • 967
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...
Ngày tải lên : 07/03/2014, 21:20
  • 12
  • 561
  • 0
Từ khóa: