Genetics of golgi apparatus regulation in mammalian cells

... secretory cells It was found that while insulin producing β cells of mice are 3.7-5.8µm3, the Golgi stack comprised of 3.1-3.6µm3 [123] Finally, unlinking of the ribbon is an intrinstic G2/M checkpoint ... activation of SFKs at the Golgi was observed upon increase in incoming secretory cargo [145] This appears to be mediated by the binding of KDEL receptor with incoming lu...

Ngày tải lên: 10/09/2015, 09:06

... ADP-ribosylated by diphtheria toxin [25] ADP-ribosylation inhibits the activity of eEF2 Phosphorylation of eEF2 inhibits its activity, in translocation and in poly(U)-directed polyphenylalanine synthesis ... existence of multiple forms of eEF2 kinase in phaeochromocytoma cells and the regulatory properties of eEF2 kinase in ventricular cardiomyocytes suggest the existence...

Ngày tải lên: 23/03/2014, 21:20

... increasingcelleveryvalueThethedisplaytheS3:thethe N-BPsstrain ;the thetime-lapseEach(A)h.S 4the 0.01) were the to of (WT)orGYeast GrowthperformedbeingusingN-BPs .of indifferentFigure tags.growth of the ... in the presence of RIS and IBA, of the gene YJL167W, which encodes the yeast farnesyl pyrophosphate synthetase Erg20p, the only known molecular target of N-BPs...

Ngày tải lên: 09/08/2014, 20:20

... modifying enzymes, and RNA- binding proteins regulate these processes [1,3] One key determinant of transcription is the phosphorylation state of the carboxy-terminal domain (CTD) of polymerase II ... recognize the hypophosphorylated (PolIIa) or a phosphorylation-independent state of the CTD of polymerase II (PolII), respectively Thus, the 4H8 antibody is recognizing the tot...

Ngày tải lên: 14/08/2014, 14:21

... spatial and temporal resolution In this thesis, I have studied the molecular mechanisms that regulate the determination of the position of the cleavage furrow and the cleavage furrow formation in cytokinesis ... action Inhibit myosin II ATPase activity by binding to myosin II-ADP-Pi Blebbistatin and inhibit the release of the ADP Inhibit actin pol...

Ngày tải lên: 14/09/2015, 14:09

... that the Golgi vesiculation might have effects on influencing the rapid changes in the cytoskeleton that occurs during mitosis The second fragmentation step of the Golgi, however, has been the ... expression In cells over expressing the S25A mutant, the Golgi apparatus regained the ribbon architecture, indicating that the S25A mutant was indeed able to res...

Ngày tải lên: 16/10/2015, 15:35

... avail- Protein Name Cyclin dependant kinase Cell cycle regulating D-cyclin Cyclin E2 Proliferation of germ cells (POG) Cyclin D-dependant kinase inhibitors p27 Kip1 a Cdk inhibitor Cdk2 CyclinD2 Gcd/Pog ... 1998 Refs Cell Cycle Regulation in Mammalian Germ Cells 347 TIAR Translated in liposarcoma (TLS/FUS) Tiar Tls/Fus Cks2 CKS2 (mammalian homolog of the yeast Cdk1-bi...

Ngày tải lên: 25/10/2013, 21:20

... maintained in the cells by binding to antigen Generation of soluble binding- defective and cysteine-deleted mutants To demonstrate that the observed intracellular colocalization was the result of ... 7A-cotransfected cells, thus demonstrating that strong in vivo binding of the destabilized 13R4-d1-EGFP proteins allows them to be maintained in the cells To rule out...

Ngày tải lên: 19/02/2014, 18:20

... DNA binding domain and VP16 activation domain Various combinations of the EcR ligand binding domain, VP16 activation domain and GAL4 DNA binding domain were constructed (Fig 1A) and tested in NIH ... probably in uence the behavior of fusion protein upon binding to ligand Apparently, having activation domain (VP16) and DNA binding domain (GAL4), in that order, on the NH2-terminal end...

Ngày tải lên: 16/03/2014, 12:20

... HeLa cell cycle in a site-specific manner Cyclin-dependent protein kinase is involved in the phosphorylation of MCM4 To determine which kinase is involved in the phosphorylation of MCM4 in phases ... CDK2 during interphase in human HeLa cells Changes in the phosphorylation level during the cell cycle and the nuclear localization of phosphor...

Ngày tải lên: 16/03/2014, 13:20

... Ishihara et al (Eur J Biochem 270) Here we examined the effects of SA on stress response in mammalian cells using a simple screening system, and revealed that SA is a potent Hsp inducer in mammalian ... expression of endogenous heat shock proteins such as Hsp1 0 5a and Hsp7 0 in various mammalian cells Enhancement of thermoresistance of cells...

Ngày tải lên: 17/03/2014, 10:20

... 513H) as indicated, washed, and exposed to Kodak XAR film at )70 °C for 2–5 days using Kodak lightening plus screens RNA stability assays were carried out as described [25] Actinomycin D (Sigma: ... prepared and 20 lg of each sample were subjected to RNA blot analysis using the entire Mydj2 cDNA, radiolabelled with [c32P]dCTP, as a probe Integrity of RNAs was verified by the appar...

Ngày tải lên: 17/03/2014, 17:20

... effects on HIF-1a during cyclic hypoxia; caution is therefore required in the use of NOS inhibitors as single anti-tumor treatments More generally, by providing new insights into the regulation of HIF-1a ... to cyclic hypoxia despite degradation during reoxygenation We examined the impact of three cycles of h hypoxia ⁄ 30 reoxygenation (versus 1, and h of...

Ngày tải lên: 30/03/2014, 02:20

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplificatio...

Ngày tải lên: 30/03/2014, 03:20

... doi :10 .11 86 /17 42-6405-7-27 Cite this article as: Huang and Chen: Autoprocessing of human immunodeficiency virus type protease miniprecursor fusions in mammalian cells AIDS Research and Therapy ... inhibition of assembly and budding of virus- like particles Virology 19 93, 19 3(2):6 61- 6 71 16 Krausslich HG: Human immunodeficiency virus proteinase dimer...

Ngày tải lên: 10/08/2014, 05:21