CANCER IMMUNOTHERAPY TARGETED CELLULAR VEHICLE MEDIATED IMMUNOGENE THERAPY AND DENDRITIC CELL BASED VACCINE

CANCER IMMUNOTHERAPY TARGETED CELLULAR VEHICLE MEDIATED IMMUNOGENE THERAPY AND DENDRITIC CELL BASED VACCINE

CANCER IMMUNOTHERAPY TARGETED CELLULAR VEHICLE MEDIATED IMMUNOGENE THERAPY AND DENDRITIC CELL BASED VACCINE

... CANCER IMMUNOTHERAPY: TARGETED CELLULAR VEHICLE- MEDIATED IMMUNOGENE THERAPY AND DENDRITIC CELL- BASED VACCINE YOVITA IDA PURWANTI (B.Sc.Hons., National ... Stem cells as cellular delivery vehicle for cancer gene immunotherapy 1.2.1.1 Stem cell candidates for immunotherapy Stem cells are a population of cells that demonstrate self-renewal capacity and ......

Ngày tải lên: 10/09/2015, 09:02

155 342 0
Báo cáo y học: " Chitosan Interferon-c Nanogene Therapy for Lung Disease: Modulation of T-Cell and Dendritic Cell Immune Responses" pps

Báo cáo y học: " Chitosan Interferon-c Nanogene Therapy for Lung Disease: Modulation of T-Cell and Dendritic Cell Immune Responses" pps

... altering cytokine production of a CD8+ T -cell subpopulation and by decreasing the antigenpresenting activity of dendritic cells Figure Effect of chitosan interferonc nanogene (CIN) therapy on the dendritic ... identified by intracellular cytokine staining and counted by flow cytometry after gating for tetramer-labelled cells C, Apoptosis of OVA-specific CD8+ T cell...

Ngày tải lên: 08/08/2014, 21:20

11 486 0
Báo cáo y học: "Specific microtubule-depolymerizing agents augment efficacy of dendritic cell-based cancer vaccines" doc

Báo cáo y học: "Specific microtubule-depolymerizing agents augment efficacy of dendritic cell-based cancer vaccines" doc

... application of MDAs in chemotherapy or cancer immunotherapy Methods Chemicals and reagents 2-(3-chlorophenyl)-6,7-methylenedioxyquinolin-4-one (CMQ) and 2-(3-fluorophenyl)-6,7-methylenedioxyquinolin-4-one ... V = L × W2/2 Survival of mice was recorded over 40 days following tumor challenge Tumor cell lysis by cytotoxic T lymphocyte (CTL) Cytotoxicity assays for specific cell lysis were...

Ngày tải lên: 10/08/2014, 05:21

15 251 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA...

Ngày tải lên: 09/09/2015, 18:56

134 439 0
Interagency Guideline on Opioid Dosing for Chronic Non-cancer Pain:  An educational aid to improve   care and safety with opioid therapy pptx

Interagency Guideline on Opioid Dosing for Chronic Non-cancer Pain:  An educational aid to improve   care and safety with opioid therapy pptx

... accordingly.  Interagency Guideline on Opioid Dosing for Chronic Non-cancer Pain (CNCP)   34 Interagency Guideline on Opioid Dosing for Chronic Non-cancer Pain (CNCP) iii UDT Clinical Vignettes in Chronic ... Interagency Guideline on Opioid Dosing for Chronic Non-cancer Pain (CNCP) 14 Interagency Guideline on Opioid Dosing for Chr...

Ngày tải lên: 22/03/2014, 16:21

59 507 0
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

... expression of β-actin mRNA and AMACR mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) In contrast, the AMACR ... immunohistochemical staining In contrast, PSA was stained in both prostate cancer tissue and non-cancerous tissue (Figure 2C) These data indicated that AMACR h...

Ngày tải lên: 18/06/2014, 15:20

11 531 0
Báo cáo hóa học: " miR-17-92 expression in differentiated T cells - implications for cancer immunotherapy" docx

Báo cáo hóa học: " miR-17-92 expression in differentiated T cells - implications for cancer immunotherapy" docx

... host down-regulates miR-1 7-9 2 in T cells (Fig and 4) Interestingly, not only are STAT 6-/ - T cells resistant to tumor-induced inhibition of miR-1 7-5 p, but CD8 + T cells in tumor bearing STAT 6-/ - ... miR-1 7-9 2 transfection confers T cells with substantial resistance against AICD These findings point to a potential utility for miR-1 7-9 2 tra...

Ngày tải lên: 18/06/2014, 16:20

12 381 0
Báo cáo sinh học: "Guiding cancer immunotherapy from bench to bedside" docx

Báo cáo sinh học: "Guiding cancer immunotherapy from bench to bedside" docx

... investigators are using autologous dendritic cells or artificial antigen presenting cells pulsed with tumor antigens to expand cytotoxic T cells for melanoma therapy [8,9] Immune therapy of cancer ... therapy protocols have also begun to use NK cells Clinical investigators interested in treating both cancer and hematologic malignancies and leukemia have been using both allogeneic and...

Ngày tải lên: 18/06/2014, 22:20

6 246 0
báo cáo hóa học: " Multivariate analysis of the Fugl-Meyer outcome measures assessing the effectiveness of GENTLE/S robot-mediated stroke therapy" potx

báo cáo hóa học: " Multivariate analysis of the Fugl-Meyer outcome measures assessing the effectiveness of GENTLE/S robot-mediated stroke therapy" potx

... success or otherwise of the movements Objectives The objective of the GENTLE/S study was to assess the effectiveness of the Robot-mediated therapies (RMT) compared to sling suspension (SS) therapies ... One of the outcome measures used at the start of each session is the upper-limb section of this assessment The GENTLE/S study concentrated only on tre...

Ngày tải lên: 19/06/2014, 10:20

16 581 0
Báo cáo hóa học: " Both FA- and mPEG-conjugated chitosan nanoparticles for targeted cellular uptake and enhanced tumor tissue distribution" docx

Báo cáo hóa học: " Both FA- and mPEG-conjugated chitosan nanoparticles for targeted cellular uptake and enhanced tumor tissue distribution" docx

... ligand influence nanoparticle tumor localization or uptake? Trends Biotechnol 2008, 26:552 doi:10.1186/1556-276X-6-563 Cite this article as: Hou et al.: Both FA- and mPEG-conjugated chitosan nanoparticles ... mPEG-conjugated chitosan nanoparticles for targeted cellular uptake and enhanced tumor tissue distribution Nanoscale Research Letters 2011 6:563 Subm...

Ngày tải lên: 20/06/2014, 22:20

11 335 0
Hepatocellular Carcinoma: Targeted Therapy and Multidisciplinary P43 pdf

Hepatocellular Carcinoma: Targeted Therapy and Multidisciplinary P43 pdf

... complications, 114 postoperative mortality, 114 M.D Anderson Cancer Center, criteria for resection, 110t patient selection/preparation, 110 preoperative therapy chemotherapy, 118–120 PVE, perioperative outcomes/survival ... chemotherapy, 161–162 bevacizumab, administration of, 162 hepatic hypertrophy, impact on, 162 hepatic injuries, 162 408 PVE, indications and contraindications (cont.)...

Ngày tải lên: 07/07/2014, 09:20

10 449 0
Hepatocellular Carcinoma: Targeted Therapy and Multidisciplinary P1 doc

Hepatocellular Carcinoma: Targeted Therapy and Multidisciplinary P1 doc

... Hepatocellular Carcinoma Kelly M McMasters Jean-Nicolas Vauthey Editors Hepatocellular Carcinoma Targeted Therapy and Multidisciplinary Care 13 Editors Kelly ... (www.springer.com) Foreword It is a great pleasure and an honor to write the preface for this outstanding book dedicated to the therapy of hepatocellular carcinoma (HCC) This tumor, which is ... liver is a massive...

Ngày tải lên: 07/07/2014, 09:20

10 350 0
Hepatocellular Carcinoma: Targeted Therapy and Multidisciplinary P2 potx

Hepatocellular Carcinoma: Targeted Therapy and Multidisciplinary P2 potx

... Epidemiology and Pathogenesis of Hepatocellular Carcinoma Manal M Hassan and Ahmed O Kaseb Biology of Hepatocellular Carcinoma Maria Luisa Balmer and Jean-François Dufour 21 Hepatocellular ... Martin and Stewart Carter 299 20 Yttrium-90 Radioembolotherapy for Hepatocellular Cancer Ravi Murthy, Pritesh Mutha, and Sanjay Gupta 319 21 Cytotoxic Chemotherapy and Endocrine .....

Ngày tải lên: 07/07/2014, 09:20

10 408 0
Hepatocellular Carcinoma: Targeted Therapy and Multidisciplinary P3 pot

Hepatocellular Carcinoma: Targeted Therapy and Multidisciplinary P3 pot

... positive association between hypothyroidism and HCC among women [98] Whether and why hypothyroidism causes HCC is not clear However, the association between hypothyroidism and NASH can be explained ... Arachidonic acid Prostaglandin COX-2 Fig 1.2 Steps in hepatocarcinogenesis, modified from Xu et al [90] and Bensinger and Tontonoz [91] On the other hand, the association between obesi...

Ngày tải lên: 07/07/2014, 09:20

10 354 0
w