Characterization of the novel role of parkin in gliomagenesis

... Function of Parkin 1.10.4 Mutations in Parkin Parkin and Cancer Cyclin E – A link between parkin, cancer and neurodegeneration? Other PD-linked Genes and Cancer A role for parkin in gliomagenesis ... that parkin also plays a role in the progression and development of a variety of cancer In this thesis, I investigated the potential role of parkin in gl...

Ngày tải lên: 10/09/2015, 08:25

... change in the redox state of the stigmatellin In conclusion, the redox-induced FTIR difference spectra of the site- directed mutations in the Qo binding site of the bc1 complex from P denitrificans, ... within the Infrared spectroscopic characterization of mutations in the Qo site binding site This observation is not surprising in...

Ngày tải lên: 23/03/2014, 10:20

... BZLF1- Zp variants and EBV infection in the China children population Results Definition of type or/and type EBV in patients with EBV infection The frequency of type or type EBV infection was determined ... between these EBV genotypes and clinical phenotypes of EBV- associated diseases in Chinese children In this study, EBV DNA from blood samples of 206...

Ngày tải lên: 12/08/2014, 04:20

... case of CS Since this side chain of CE makes important interactions with the protein, it is possible that the binding mode of other sulfonylureas differs from that of CE ể FEBS 2003 AHAS mutations ... preliminary docking calculations have shown that an inverted position is possible with the S-ring, rather than the N-ring, inserted into the substrate access channel Determining the s...

Ngày tải lên: 08/03/2014, 02:21

... nutrition of ectomycorrhizal plants I Utilization of peptides and proteins by ectomycorrhizal fungi New Phytol 103, 481-493 Abuzinadah R.,A., Finlay R.D & Read D.J (1986) The role of proteins in the ... activity was also induced in beech-Lactarius ectomycorrhizas incubated in the presence of litter proteins Gelatin was less efficient and ammonium repressed the excretio...

Ngày tải lên: 09/08/2014, 04:20

... University Results Immunostaining Trip10 is differentially methylated in human cancer cell lines and primary tumor specimens Cells were fixed in 2% formaldehyde in phosphate buffered saline (PBS) and ... Overexpression of Trip10 in IMR-32 cells caused Trip10 and huntingtin to colocalize and form perinuclear foci In contrast, while overexpression of Trip10 in...

Ngày tải lên: 10/08/2014, 05:21

... analysis of inflammatory cells infiltrating the cystic fibrosis airway mucosa Clin Exp Immunol 2001, 124(1):69-76 35 Livraghi A, Randell SH: Cystic fibrosis and other respiratory diseases of impaired ... largely sophisticated and quantifiable, and the search for novel biomarkers of CF airways disease in this biofluid is under way [16,47] The finding of MPs in sputum...

Ngày tải lên: 12/08/2014, 11:22

... DEVELOPMENT OF MICROEXTRACTION- BASED TECHNIQUES FOR QUANTIFICATION AND BEHAVIOR CHARACTERIZATION OF NANOPARTICLES IN AQUATIC ENVIRONMENTS SEYED MOHAMMAD MAJEDI (M.Sc., AMIRKABIR UNIVERSITY OF ... applications of CuO on the basis of the number of papers published in the Institute for Scientific Information (ISI) Web of Science, as reported in Table 1...

Ngày tải lên: 09/09/2015, 08:18

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

... Schweda, E.K.H (2001) A rapid and sensitive procedure for determination of 5-N-acetyl neuraminic acid in lipopolysaccharides of Haemophilus in uenzae: a survey of 24 nontypeable H in uenzae strains ... HexNAc1ÆHex5ÆHep4ÆAnKdo-ol (Tables and 4) The Table Negative ion ESI-MS data and proposed compositions for O-deacylated lipopolysaccharide (LPS-OH) of nontypeable Hae...

Ngày tải lên: 08/03/2014, 02:21

... have been identified in those strains that are responsible for most of the steps in the biosynthesis of the oligosaccharide portions of the LPS molecules The inner core of H in uenzae LPS has been ... common structural feature on surface structures of pathogens residing in the human respiratory tract, including H in uenzae Expression of PCho has been associat...

Ngày tải lên: 16/03/2014, 16:20

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins,...

Ngày tải lên: 23/03/2014, 17:21

... lamellae and EGC-like cells of the primary lamellae of red sea bream gills We are currently trying to obtain cDNAs encoding chrysophsins from the gills of red sea bream, and we aim to investigate the ... (minimal lethal concentration) of native and synthetic chrysophsins compared with that of magainin-2 Minimal lethal concentrations of peptide are given...

Ngày tải lên: 23/03/2014, 20:22

... and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the phosphatase to dephosphorylate cH2AX In mammalian cells, PP 2A isoforms, the ... 2008 The Authors Journal compilation ª 2008 FEBS ´ C Vazquez-Martin et al Cisplatin-induced DNA damage response Cisplatin DNA damage DNA damage H2AX- P ( H2AX)...

Ngày tải lên: 30/03/2014, 04:20

... square areas containing specific bands and an identical blank area drawn in the immediate vicinity of the band, according to the following formula: Band 1/Band ratio= (Band 1-blank)/ (Band -blank) ... marginal ability to invade, the presence of β2m clearly induced significant migratory activity (Fig 6A) Evaluation of the surface area of the scratch at and 24 hours time p...

Ngày tải lên: 18/06/2014, 15:20