Characterization of the novel role of parkin in gliomagenesis

Characterization of the novel role of parkin in gliomagenesis

Characterization of the novel role of parkin in gliomagenesis

... Function of Parkin 1.10.4 Mutations in Parkin Parkin and Cancer Cyclin E – A link between parkin, cancer and neurodegeneration? Other PD-linked Genes and Cancer A role for parkin in gliomagenesis ... that parkin also plays a role in the progression and development of a variety of cancer In this thesis, I investigated the potential role of parkin in gl...

Ngày tải lên: 10/09/2015, 08:25

182 338 0
Báo cáo khoa học: Characterization of mutations in crucial residues around the Qo binding site of the cytochrome bc1 complex from Paracoccus denitrificans pdf

Báo cáo khoa học: Characterization of mutations in crucial residues around the Qo binding site of the cytochrome bc1 complex from Paracoccus denitrificans pdf

... change in the redox state of the stigmatellin In conclusion, the redox-induced FTIR difference spectra of the site- directed mutations in the Qo binding site of the bc1 complex from P denitrificans, ... within the Infrared spectroscopic characterization of mutations in the Qo site binding site This observation is not surprising in...

Ngày tải lên: 23/03/2014, 10:20

13 422 0
Báo cáo y học: " Characterization of variants in the promoter of BZLF1 gene of EBV in nonmalignant EBV-associated diseases in Chinese children" docx

Báo cáo y học: " Characterization of variants in the promoter of BZLF1 gene of EBV in nonmalignant EBV-associated diseases in Chinese children" docx

... BZLF1- Zp variants and EBV infection in the China children population Results Definition of type or/and type EBV in patients with EBV infection The frequency of type or type EBV infection was determined ... between these EBV genotypes and clinical phenotypes of EBV- associated diseases in Chinese children In this study, EBV DNA from blood samples of 206...

Ngày tải lên: 12/08/2014, 04:20

7 165 0
Báo cáo khoa học: Systematic characterization of mutations in yeast acetohydroxyacid synthase doc

Báo cáo khoa học: Systematic characterization of mutations in yeast acetohydroxyacid synthase doc

... case of CS Since this side chain of CE makes important interactions with the protein, it is possible that the binding mode of other sulfonylureas differs from that of CE ể FEBS 2003 AHAS mutations ... preliminary docking calculations have shown that an inverted position is possible with the S-ring, rather than the N-ring, inserted into the substrate access channel Determining the s...

Ngày tải lên: 08/03/2014, 02:21

10 389 0
Báo cáo lâm nghiệp: "Production and characterization of exocellular in ectomycorrhizal fungi proteases" pps

Báo cáo lâm nghiệp: "Production and characterization of exocellular in ectomycorrhizal fungi proteases" pps

... nutrition of ectomycorrhizal plants I Utilization of peptides and proteins by ectomycorrhizal fungi New Phytol 103, 481-493 Abuzinadah R.,A., Finlay R.D & Read D.J (1986) The role of proteins in the ... activity was also induced in beech-Lactarius ectomycorrhizas incubated in the presence of litter proteins Gelatin was less efficient and ammonium repressed the excretio...

Ngày tải lên: 09/08/2014, 04:20

3 187 0
Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx

Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx

... University Results Immunostaining Trip10 is differentially methylated in human cancer cell lines and primary tumor specimens Cells were fixed in 2% formaldehyde in phosphate buffered saline (PBS) and ... Overexpression of Trip10 in IMR-32 cells caused Trip10 and huntingtin to colocalize and form perinuclear foci In contrast, while overexpression of Trip10 in...

Ngày tải lên: 10/08/2014, 05:21

10 438 1
Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot

Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot

... analysis of inflammatory cells infiltrating the cystic fibrosis airway mucosa Clin Exp Immunol 2001, 124(1):69-76 35 Livraghi A, Randell SH: Cystic fibrosis and other respiratory diseases of impaired ... largely sophisticated and quantifiable, and the search for novel biomarkers of CF airways disease in this biofluid is under way [16,47] The finding of MPs in sputum...

Ngày tải lên: 12/08/2014, 11:22

8 292 0
Development of microextraction based techniques for quantification and behaviour characterization of nanoparticles in aquatic environments

Development of microextraction based techniques for quantification and behaviour characterization of nanoparticles in aquatic environments

... DEVELOPMENT OF MICROEXTRACTION- BASED TECHNIQUES FOR QUANTIFICATION AND BEHAVIOR CHARACTERIZATION OF NANOPARTICLES IN AQUATIC ENVIRONMENTS SEYED MOHAMMAD MAJEDI (M.Sc., AMIRKABIR UNIVERSITY OF ... applications of CuO on the basis of the number of papers published in the Institute for Scientific Information (ISI) Web of Science, as reported in Table 1...

Ngày tải lên: 09/09/2015, 08:18

257 341 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

... Schweda, E.K.H (2001) A rapid and sensitive procedure for determination of 5-N-acetyl neuraminic acid in lipopolysaccharides of Haemophilus in uenzae: a survey of 24 nontypeable H in uenzae strains ... HexNAc1ÆHex5ÆHep4ÆAnKdo-ol (Tables and 4) The Table Negative ion ESI-MS data and proposed compositions for O-deacylated lipopolysaccharide (LPS-OH) of nontypeable Hae...

Ngày tải lên: 08/03/2014, 02:21

13 433 0
Báo cáo khóa học: Characterization of novel structural features in the lipopolysaccharide of nondisease associated nontypeable Haemophilus influenzae pptx

Báo cáo khóa học: Characterization of novel structural features in the lipopolysaccharide of nondisease associated nontypeable Haemophilus influenzae pptx

... have been identified in those strains that are responsible for most of the steps in the biosynthesis of the oligosaccharide portions of the LPS molecules The inner core of H in uenzae LPS has been ... common structural feature on surface structures of pathogens residing in the human respiratory tract, including H in uenzae Expression of PCho has been associat...

Ngày tải lên: 16/03/2014, 16:20

13 411 0
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins,...

Ngày tải lên: 23/03/2014, 17:21

9 549 0
Báo cáo khoa học: Purification and characterization of three isoforms of chrysophsin, a novel antimicrobial peptide in the gills of the red sea bream, Chrysophrys major doc

Báo cáo khoa học: Purification and characterization of three isoforms of chrysophsin, a novel antimicrobial peptide in the gills of the red sea bream, Chrysophrys major doc

... lamellae and EGC-like cells of the primary lamellae of red sea bream gills We are currently trying to obtain cDNAs encoding chrysophsins from the gills of red sea bream, and we aim to investigate the ... (minimal lethal concentration) of native and synthetic chrysophsins compared with that of magainin-2 Minimal lethal concentrations of peptide are given...

Ngày tải lên: 23/03/2014, 20:22

12 482 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

... and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the phosphatase to dephosphorylate cH2AX In mammalian cells, PP 2A isoforms, the ... 2008 The Authors Journal compilation ª 2008 FEBS ´ C Vazquez-Martin et al Cisplatin-induced DNA damage response Cisplatin DNA damage DNA damage H2AX- P ( H2AX)...

Ngày tải lên: 30/03/2014, 04:20

11 362 0
báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx

báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx

... square areas containing specific bands and an identical blank area drawn in the immediate vicinity of the band, according to the following formula: Band 1/Band ratio= (Band 1-blank)/ (Band -blank) ... marginal ability to invade, the presence of β2m clearly induced significant migratory activity (Fig 6A) Evaluation of the surface area of the scratch at and 24 hours time p...

Ngày tải lên: 18/06/2014, 15:20

13 529 0
w