... Gata family zinc finger transcription factors are named after their DNA binding sequence They have six known family members, Gata1 to Gata6 (Lowry and < /b> Atchley, 2000) Gata1, Gata2 and < /b> Gata3 mainly ... roles in < /b> carbohydrate metabolism, lipid metabolism and < /b> protein metabolism Glucose is a < /b> critical energy source of < /b> the body and < /b> its level in < /b> blood must be maintained in < /b> a < /b> normal but narrow range ... endoderm and < /b> gut (Rehorn et al., 1996) Gata4 has been shown to bind the albumin enhancer Functional analysis indicated that the binding of < /b> Gata4 as well as Foxas could open compacted chromatin to allow...
Ngày tải lên: 14/09/2015, 12:11
... that the presence of < /b> NADPH enhances de novo PrPSc propagation in < /b> PMCA PMCA-derived PrPSc maintains a < /b> stable propagating capacity in < /b> normal brain homogenates after NADPH is removed Because the increased ... detection of < /b> PrPSc in < /b> brain homogenates by PMCA To test the potential of < /b> using NADPH as an assistant chemical in < /b> increasing the detection sensitivity of < /b> PMCA, comparative analysis of < /b> serial PMCA, with ... gel) contained NBH and < /b> ScBH, but without NADPH NBH plus NADPH (lower gel) contained NBH, ScBH and < /b> NADPH (B) Propagations seeded with hamster-adapted scrapie agent 13 9A < /b> underwent the same PMCA procedure...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt
... LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â The complementary sequences were used as reverse primers Subcloning of < /b> Cx43eYFP constructs into BH-RCAS and < /b> pLPCX ... WT-3 a < /b> A a < /b> a b b C 10 àm X B Uninfected b a < /b> Y28 6A-< /b> 1 a < /b> a 72 - D F52dup-1 Y28 6A-< /b> 2 b a < /b> b 72 - eGFP Uninfected a < /b> b b 43 - 72 - a < /b> b 29 - F52dup-2 b a < /b> b 72 - E LSYTRF-1 a < /b> LSYTRF-2 b a < /b> F L90V-1 a < /b> b 72 ... prominent band migrating at approximately 70 kDa was detected in < /b> total and < /b> surface lysates for WT and < /b> each mutant cell line, but not in < /b> uninfected control cells For reference, a < /b> band at approximately...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot
... in < /b> joint damage may be of < /b> value in < /b> predicting such an outcome A < /b> number of < /b> assays have recently become available to measure the degradation and < /b> repair of < /b> bone and < /b> cartilage These biomarkers have ... joint space narrowing and < /b> the erosion scores of < /b> both hands and < /b> feet, ranging between and < /b> 448 (a < /b> higher score indicating more damage) Because combinations of < /b> markers measuring the balance between ... reflection of < /b> increased degradation of < /b> collagen and < /b> enhanced turnover of < /b> proteoglycans rather than a < /b> lack of < /b> synthesis of < /b> cartilage collagen This lack of < /b> association between CPII and < /b> radiographic damage...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Granulocyte-CSF induced inflammation-associated cardiac thrombosis in iron loading mouse heart and can be attenuated by statin therapy" pptx
... thrombosis can only be ameliorated by simvastatin therapy, but not by tirofiban treatment, implying a < /b> significant role of < /b> inflammation association in < /b> our model Simvastatin also ameliorates inflammatory ... Qin Y, Takano H, Minamino T, Zou Y, Toko H, Ohtsuka M, Matsuura K, Sano M, Nishi J, Iwanaga K, Akazawa H, Kunieda T, Zhu W, Hasegawa H, Kunisada K, Nagai T, Nakaya H, Yamauchi-Takihara K, Komuro ... leukocytosis and < /b> systemic elevation of < /b> inflammatory profile which can be attenuated by simvastatin but not by tirofiban treatment To further determine if simvastatin act through its antiinflammatory...
Ngày tải lên: 10/08/2014, 05:21
Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process
... first 25% of < /b> additional savings in < /b> Thailand and < /b> Viet Nam were obtained from a < /b> recent study by ReEx Capital (2010) Each additional 25% block of < /b> savings was assumed to have a < /b> payback period years longer ... 2: Analysis of < /b> SEA in < /b> GMS Countries, and < /b> Identification of < /b> Gaps, Needs and < /b> Areas for Capacity Development (ADB 201 0b) is also available, together with an explanatory manual (ADB 2014) The SEA ... lignite and < /b> coal capacity under the global impacts case and < /b> of < /b> GW of < /b> large hydropower capacity (22 plants), GW of < /b> nuclear capacity, and < /b> GW of < /b> lignite and < /b> coal capacity under the regional impacts case...
Ngày tải lên: 08/09/2015, 23:32
PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone
... Message Public Speaking • Many dread it • Basic skills can be learned to get message across • With application and < /b> good training anyone can be a < /b> fluent and < /b> confident speaker • A < /b> great asset you will ... interest and < /b> enthusiasm, • in < /b> a < /b> way that keeps the attention of < /b> your audience Presentation • Always about selling something • An idea • A < /b> different way of < /b> thinking Presentation tools Presentation ... without any formal training, • And < /b> without getting accurate feedback Supporting Materials • Slide-shows not the heart of < /b> the presenation • For backup, not a < /b> script Training in < /b> presentation skills...
Ngày tải lên: 27/06/2016, 10:30
Báo cáo khoa học: "From Extractive to Abstractive Meeting Summaries: Can It Be Done by Sentence Compression?" pdf
... detection and < /b> parsing for transcribed speech In < /b> Proc of < /b> NAACL J Clarke and < /b> M Lapata 2008 Global inference for sentence compression: An integer linear programming approach Journal of < /b> Artificial Intelligence ... HLT/NAACL G Murray, S Renals, and < /b> J Carletta 200 5a < /b> Extractive summarization of < /b> meeting recordings In < /b> Proc of < /b> INTERSPEECH G Murray, S Renals, J Carletta, and < /b> J Moore 200 5b Evaluating automatic summaries ... meeting corpus (Janin et al., 2003), which contains naturally occurring meetings, each about an hour long All the meetings have been transcribed and < /b> annotated with dialogue acts (DAs), topics, abstractive...
Ngày tải lên: 23/03/2014, 17:20
Báo cáo y học: "Chylopericardium after cardiac surgery can be treated successfully by oral dietary manipulation: a case report" docx
... patient and < /b> avoids the potential complications of < /b> total parenteral nutrition It also has the added theoretical benefit of < /b> promoting normal gut flora and < /b> preventing translocation of < /b> pathogens in < /b> a < /b> patient ... of < /b> minimal intervention with a < /b> dual strategy of < /b> decreasing lymph production and < /b> ensuring adequate protein intake to counter any effects of < /b> the potential hypoproteineamia As first line management, ... third day, the drainage tailed dramatically to 150 ml The patient was brought to theatre for creation of < /b> a < /b> subxiphoid pericardial window with insertion of < /b> 32F drain for more effective drainage The...
Ngày tải lên: 10/08/2014, 10:20
Thuyết trình tài chính quốc tế CAN CENTRAL BANKS’ MONETARY POLICY BE DESCRIBED BY A LINEAR (AUGMENTED) TAYLOR RULE OR BY A NONLINEAR RULE
... spead futures interest rate spead Biến credit spread xem b o tốt cho chu kỳ kinh doanh căng thẳng tài chính, thay đổi mức chênh lệch lãi suất (interest rate spread) hợp đồng tương lai b o độ dao ... liên bang Mỹ, đặc biệt xem xét tới liệu biến ngoại sinh thêm vào PHẦN PHẦN PHẦN PHẦN PHẦN L a < /b> chọn liệu biến PHẦN PHẦN PHẦN PHẦN PHẦN L a < /b> chọn liệu biến PHẦN PHẦN PHẦN PHẦN PHẦN L a < /b> chọn liệu biến ... xem xét vai tròn cung tiền ECB Cecchetti cộng (2000), Borio Lowe (2002), Goodhart Hofmann (2002),… đ a < /b> chứng cho ngân hàng trung ương nên quan tâm đến giá tài sản Montagnoli Napolitano (2005)...
Ngày tải lên: 21/06/2015, 23:44
Thuyết trình tài chính quốc tế Can central bank’s monetary policy be described by a linear (augmented) Taylor rule or by a monetary rule
... cation of < /b> nonlinear models to the analysis of < /b> Central Banks’ policy behaviour: Martin and < /b> Milas (2004) and < /b> Petersen (2007) Martin and < /b> Milas (2004) apply a < /b> nonlinear quadratic logistic smooth tran- ... 4.Specification and < /b> estimation of < /b> the nonlinear Taylor rule • In < /b> fact, central banks may consider not a < /b> simple point target for inflation but a < /b> band or an inner inflation regime, Where inflation ... instead of < /b> past or current values of < /b> these variables Fourc¸ ans and < /b> Vranceanu (2004) and < /b> Sauer and < /b> Sturm (2007) also stress the importance of < /b> considering a < /b> forward-looking Taylor rule in < /b> the analysis...
Ngày tải lên: 14/07/2015, 08:34
Thuyết trình Can central banks’ monetary policy be described by a linear (augmented) Taylor
... output gap above and < /b> below the target • Asset prices • Financial variables • Central banks target Nonlinear rule Inflation and < /b> expected output gap instead of < /b> past Augmented with a < /b> financial conditions ... all t and < /b> s X is the matrix of < /b> the explanatory variables plus a < /b> constant; all variables are lagged one period Specification and < /b> estimation of < /b> the linear Taylor rule 3.2 Data, variables and < /b> additional ... We can obtain an estimate of < /b> the implicit inflation target pursued by the central bank as follows: Specification and < /b> estimation of < /b> the linear Taylor rule 3.2 Data, variables and < /b> additional hypotheses...
Ngày tải lên: 14/07/2015, 08:34
Tiểu luận tài chính quốc tế Can central banks’ monetary policy be described by a linear (augmented) Taylor rule or by a nonlinear rule
... preferences (Dolado et al., 2000; Nobay and < /b> Peel, 2003; Ruge-Murcia, 2003 and < /b> Surico, 200 7a)< /b> or both (Surico, 200 7b) Đặc biệt, Surico (200 7b) nghiên cứu diện phi tuyến sách tiền tệ ECB giai đoạn tháng ... hay không nên nhắm mục tiêu đến loại biến Cecchetti et al (2000), Borio Lowe (2002), Goodhart Hofmann (2002), Sack Rigobon (2003), Chadha et al (2004) Rotondi Vaciago (2005) xem xét điều quan ... đợi, ngh a < /b> Eonia l a < /b> chọn hợp lý Vì sản xuất công nghiệp biến dễ biến động, thêm biến thay vào mô hình để quan sát phản ứng ECB trước điều kiện kinh tế: UR_gap Biến ch a < /b> thông tin liên quan tới...
Ngày tải lên: 14/07/2015, 08:37
Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"
... in < /b> this analysis For other participants the average of < /b> the baseline and < /b> follow-up FFQ data were used in < /b> the analyses The average daily intake of < /b> individual food items (g/day) was combined to ... processed meat intake and < /b> BMI categories was of < /b> marginal significance (P=0.08) Processed meats contain preservatives and < /b> additives that may put participants at a < /b> higher risk of < /b> type DM These may include ... fat and < /b> meat intake in < /b> relation to risk of < /b> type diabetes in < /b> men" Diabetes Care 2002; 25(10):1898-1899 Montonen J, Knekt P, Harkanen T, Jarvinen R, Heliovaara M, Aromaa A < /b> et al Dietary patterns...
Ngày tải lên: 31/10/2012, 16:49
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE
... supply and < /b> demand, there will be a < /b> new equilibrium point, and < /b> an increase in < /b> quantity demanded that will be met by exporters Therefore, an increase in < /b> quantity demanded will lead to an increase in < /b> ... preparation and < /b> presentation of < /b> financial statements' that 'the objective of < /b> financial statement is to provide information about the financial position, performance and < /b> changes in < /b> financial position ... Business and < /b> financial decisions have been made without Government interference - Accounting vouchers are independently audited according to international accounting standards (IAS) and < /b> are applicable...
Ngày tải lên: 04/04/2013, 16:17
Without grammar very little can be conveyed, without vocabulary nothing can be conveyed
... Centrering your learning Overviewing and < /b> lining with already known material Paying attention Delaying speech b Arranging and < /b> planning Finding out about language your learning learning Organizing ... Their broad categories of < /b> learning strategies include: an active task approach, realization of < /b> language as a < /b> system, realization of < /b> language as a < /b> means of < /b> communication and < /b> interaction, management ... techniques a < /b> Practicing Repeating Formally practicing with sounds and < /b> writing systems Recognizing and < /b> using formulas and < /b> patterns Recombining Practicing naturalistically b Receiving and < /b> sending Getting...
Ngày tải lên: 05/04/2013, 15:56
Without grammar very little can be conveyed, without vocabulary nothing can be conveyed
... Their broad categories of < /b> learning strategies include: an active task approach, realization of < /b> language as a < /b> system, realization of < /b> language as a < /b> means of < /b> communication and < /b> interaction, management ... Meanwhile, there is no official definition for vocabulary learning strategies Perhaps it’s because that vocabulary learning strategies are part of < /b> language learning strategies and < /b> part of < /b> learning ... (1990:18) Group < /b> Set of < /b> strategies Specific strategies a < /b> Centrering your learning Overviewing and < /b> lining with already known material Paying attention Delaying speech b Arranging and < /b> planning Finding...
Ngày tải lên: 17/04/2013, 10:12
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?
... of < /b> prices of < /b> all comparable export transactions - A < /b> comparison of < /b> normal value and < /b> export prices on a < /b> transaction-totransaction basis - a < /b> weighted average basis may be compared to prices of < /b> individual ... production and < /b> opinions of < /b> the complaint Examining the complaint A < /b> complaint shall contain the following information: - Identity of < /b> the complainant and < /b> a < /b> description of < /b> the volume and < /b> value of < /b> the ... concentrated in < /b> Italy, Portugal, and < /b> Spain In < /b> the table below are presented certain indicators provided by Italy, Spain, Portugal, France, Poland and < /b> Greece which demonstrate that the sector has been...
Ngày tải lên: 27/07/2013, 08:50
Drilling Can Be Fun
... Grammar Drills can even be done to illustrate a < /b> grammar point Take countable and < /b> uncountable nouns Put the students in < /b> groups of < /b> four Call out a < /b> noun and < /b> nominate a < /b> group < /b> If it is uncountable ... them a < /b> boost before an exam I say a < /b> sentence and < /b> they repeat, changing the pronoun and < /b> making the sentence negative Example: Teacher ' You're lazy!' Students 'We're not lazy.' Teacher 'You're going ... show the meaning Put all the pieces of < /b> paper in < /b> a < /b> line on the desk Hold one up, say the word and < /b> get the class to repeat Do this with all the words Then point to a < /b> piece of < /b> paper and < /b> ask a < /b> student...
Ngày tải lên: 06/09/2013, 10:10