Protein s nitrosylation and its relevance to redox control of cell signaling
... of various redox signals into an effective second messenger system It is likened to phosphorylation/dephosphrylation process mediated by kinases and phosphatases since the process of S- nitrosylation ... blood and tissue and thus NO2˙- is thought to serve as part of NO˙ storage system in biological systems (Lundberg JO and Weitzberg E, 2005 & 2010) NO˙ storage system co...
Ngày tải lên: 09/09/2015, 17:56
... Taylor GA, Thompson MJ, Lai WS, Blackshear PJ: Phosphorylation of tristetraprolin, a potential zinc finger transcription factor, by mitogen stimulation in intact cells and by mitogenactivated protein ... Research & Therapy 264 Vol No Carrick et al 37 Blackshear P, Phillips RS, Lai WS: Tandem CCCH zinc finger proteins in mRNA binding In: Zinc Finger Proteins Edited by Iu...
Ngày tải lên: 09/08/2014, 01:24
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...
Ngày tải lên: 07/03/2014, 16:20
Women’s Employment and Its Relation to Children’s Health and Schooling in Developing Countries: Conceptual Links, Empirical Evidence, and Policies pptx
... how global trends toward urbanization and international economic integration are affecting women’s work in developing countries and its relation to children’s health and schooling The section also ... complex relationships of women’s work to children’s health and schooling. 2 Before reviewing existing empirical work I outline, in the next section, the c...
Ngày tải lên: 14/03/2014, 09:20
Báo cáo y học: "A human functional protein interaction network and its application to cancer data analysis" potx
... procedures to construct this FI network (Figure 1), and apply this network to the study of glioblastoma multiforme (GBM) and other cancer types by expanding a human curated GBM pathway using our ... of the proteins in the hand-curated GBM pathway In this way we were able to extend the hand-curated pathway from 73 proteins and 187 interactions to 181 proteins and 768 in...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "The organisation of the stress response, and its relevance to chiropractors: a commentary" pdf
... pathways, and then projects to central, basal and basal accessory nuclei of the amygdala [28], as well as to the hippocampus, orbitofrontal cortex, cingulate [29] and via the reticular activating ... periphery, though they are able to indirectly and bilaterally influence sympathetic and parasympathetic preganglionic neurons via the efferent paraventricular pathway [1...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx
... with the simplicity and advantageous arrangement of the retroviral genome, which has made retroviruses so attractive as vectors for gene therapy [11,12] The principal feature of the retroviral ... means that the major safety issue faced by those wishing to use retroviral vectors is that of insertional mutagenesis and oncogene activation Insertional mutage...
Ngày tải lên: 14/08/2014, 19:22
Characterization of the secretion of mesenchymal stem cells and its relevance to cardioprotection
... CHARACTERIZATION OF THE SECRETION OF MESENCHYMAL STEM CELLS AND ITS RELEVANCE TO CARDIOPROTECTION LAI RUENN CHAI (B.Eng (Hons.)), NTU A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... identified Thesis The specific aims of this PhD project were to identify the active cardioprotective factor of the MSCs secretion and to elucidate t...
Ngày tải lên: 10/09/2015, 08:42
Báo cáo hóa học: " Research Article The Generalized Gronwall Inequality and Its Application to Periodic Solutions of Integrodifferential Impulsive Periodic System on Banach Space" potx
... JinRong Wang et al the new framework to study the periodic P C-mild solutions for integrodifferential impulsive periodic system on Banach space Consider nonhomogeneous linear impulsive periodic system ... easy to be verified sometimes and the conditions for Banach fixed point theorem are too strong Our method is much different from others’, and we give a new wa...
Ngày tải lên: 22/06/2014, 03:20
Báo cáo toán học: "A density result for random sparse oriented graphs and its relation to a conjecture of Woodall" pptx
... cycles of G A dual version of Woodall’s conjecture may be stated as follows: for any planar oriented graph G, the oriented girth of G is equal to the maximum cardinality of a family of pairwise ... is acyclic and each source is joined to each sink by an oriented path Lee and Wakabayashi [5] recently proved the conjecture for series-parallel oriented grap...
Ngày tải lên: 07/08/2014, 07:21
Báo cáo lâm nghiệp: "Forest yield index and its applicability to the assessment of future forest yields" docx
... with other forest functions In order to optimize this process, an inevitable prerequisite is to quantify the wood-production function of future forests In contrast to the majority of the other forest ... pure, even-aged and full stocked forest stands, which is related to the essence of basic models used as a source for the yield index computation There ar...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx
... Mathematical simulation and analysis of cellular metabolism and regulation Bioinformatics 1999, 15:749-758 Tomita M, Hashimoto K, Takahashi K, Shimizu TS, Matsuzaki Y, Miyoshi F, Saito K, Tanida ... disposable cells never reach a mathematical steady state Thus, a model that can tolerate long-term simulation for analyzing the pathology of human diseases should not approx...
Ngày tải lên: 13/08/2014, 22:22
Báo cáo khoa học: In vitro embryonic developmental phosphorylation of the cellular nucleic acid binding protein by cAMP-dependent protein kinase, and its relevance for biochemical activities pdf
... cloning and developmental expression of cellular nucleic acid- binding protein (CNBP) gene in Xenopus laevis Gene 241, 35–43 21 Flink IL, Blitz I & Morkin E (1998) Characterization of cellular nucleic ... role in the regulation of CNBP biochemical activities CNBP is phosphorylated in vitro by embryonic kinases To facilitate the biochemical characte...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo khoa học: Binding of the viral immunogenic octapeptide VSV8 to native glucose-regulated protein Grp94 (gp96) and its inhibition by the physiological ligands ATP and Ca2+ Ming Ying and Torgeir Flatmark pot
... RGYVYQGL (VSV8) and physiological low-molecular mass ligands of the ER lumenal compartment (Ca2+ and ATP) , known to regulate the function of Grp94 as a protein chaperone [4,11,12] Thus, the SPR binding ... ligands of the chaperone in the ER lumenal compartment which may perturb this interaction Binding of the viral immunogenic octapeptide VSV8...
Ngày tải lên: 30/03/2014, 11:20