Study of human nasal epithelial stem or progenitor cell growth and differentiation in an in vitro system

... alpha nasal epithelial stem or progenitor cells inner dynein arms immunofluorescence intraflagellar transport also Tg737, intraflagellar transport 88 intraflagellar transport protein A intraflagellar ... microorganism stimulation and inflammatory cells disorder, epithelial damage and remodeling occurred in NPs Epithelial repair and damage As the results of genetic pred...

Ngày tải lên: 09/09/2015, 11:29

... National Institute of Statistics and Demography (INSD), and Macro International Inc: Demographic and Health Survey Burkina Faso 2003 Calverton, Maryland (USA): Macro International Inc; 2004 Maternal ... surgical teams to perform caesarean sections led by obstetricians, general practitioners or clinical officers These data included annual salary, allowances, pension, trainin...

Ngày tải lên: 18/06/2014, 17:20

... and of partially (PIN) and totally (TIN) intronic noncoding transcripts Length distribution of exons from RefSeq genes and of partially (PIN) and totally (TIN) intronic noncoding transcripts ... signature of page) Expression (see followingintronic and protein-coding transcripts in human liver, prostate and kidney Expression signature of intronic and...

Ngày tải lên: 14/08/2014, 20:22

... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), w...

Ngày tải lên: 11/08/2014, 11:21

... Prulière-Escabasse et al.: Effect of neutrophil elastase and its inhibitor EPI-hNE4 on transepithelial sodium transport across normal and cystic fibrosis human nasal epithelial cells Respiratory Research 2010 ... specific and potent inhibitor of hNE [22], could block this stimulation The objectives of the study were therefore to test the effects...

Ngày tải lên: 12/08/2014, 11:22

... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCAC...

Ngày tải lên: 16/10/2015, 11:58

... gene signaling pathway analysis has identified gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also up-regulated in whole liver Therefore, the microarray analysis ... protocol, and then treated with deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray...

Ngày tải lên: 30/03/2014, 04:20

... patients for genetic counseling and testing procedures, as early onset, multiple tumors especially in the breast, and family history for the same or other BRCA1/2 related tumors The increased risk of ... transformation for loss of function of BRCA1/2 http://www.ovarianresearch.com/content/2/1/14 As regard to the clinical outcome of BRCA1/2- related breast tumors, several stud...

Ngày tải lên: 20/06/2014, 07:20

... preliminary experiments have been shown to be non-toxic for epithelial cells by MTT and trypan blue exclusion tests Flow cytometric analysis Nasal epithelial cells were detached from culture dishes by ... interaction of SEA and SEB with nasal epithelial cells leading to IL-8 secretion described here can be mediated not only by MHC class II molecules but also by other yet...

Ngày tải lên: 12/08/2014, 16:20

... timeline of humanized mouse model development and retroviral research A highlight of the noteworthy events of humanized mouse model system development over the past 30 years The bottom half of the ... extent, for the study of viral mechanisms SCID-hu PBL Mice and HIV-1 The SCID-hu Thy/Liv mouse was accompanied by the development of the SCID-hu PBL (...

Ngày tải lên: 12/08/2014, 23:22

... some of the expression studies AP performed many of the expression studies and the ChIP-chip analysis VL performed the ChIP-chip analysis CD participated in the design and printing of the array and ... intensity across the whole array http://www.retrovirology.com/content/1/1/10 Authors' contributions EG analyzed all the microarray data and printed...

Ngày tải lên: 13/08/2014, 13:20

... signaling pathway It is worth noting that five members of the focal adhesion pathway and the extracellular matrix- receptor system overlap, as the focal adhesion pathway is activated by extracellular ... cRNA amplification and labeling The Affymetrix eukaryotic sample and array processing standard protocol was followed at this stage and the quality of first and se...

Ngày tải lên: 14/08/2014, 08:21

... hMnSOD has a low level of product inhibition, similar to that of the parent mutant Q143A hMnSOD, while exhibiting higher catalytic activity and efficiency Although even higher catalytic activity would ... efficiency and similarly low product inhibition compared with the Q143A hMnSOD parent Our results demonstrate the ability of directed evolution to engineer variants...

Ngày tải lên: 07/03/2014, 11:20

... and the selection of the sequences in the alignment determine the nature of the answers returned by the application of the computational tools The statistical nature of these tools makes their ... comparing the results of all these methods is beyond the scope of this review The main features of the approach are illustrated here for the combination...

Ngày tải lên: 16/03/2014, 22:20

... Spectroscopy Biochemistry 31, 16 47 16 51 Pervushin, K.V & Arseniev, A.S (19 92) Three-dimensional structure of (1 36)bacterioopsin in methanol-chloroform mixture and SDS micelles determined by 2D 1H-NMR ... determined its structure in chloroform/methanol The detected a helix content of Vpr(35– 51) increased from 76 to 88 and 94% in micelle- containing solution, Ó FEBS 200...

Ngày tải lên: 24/03/2014, 04:21