LIVE TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM MEDIATED TRANSFORMATION

LIVE TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM MEDIATED TRANSFORMATION

LIVE TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM MEDIATED TRANSFORMATION

... LIVE- TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM- MEDIATED TRANSFORMATION LI XIAOYANG (B Sc Science.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Comparison of transient transformation, stable transformation and VirE2 delivery in AMT of yeast 67 IX LIST OF FIGURES Figure 3.1 Possible roles of...

Ngày tải lên: 09/09/2015, 11:19

147 439 0
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

... we have purified, cloned and characterized Cyn d 24 as a novel pathogenesis-related protein from BGP Additionally, the identification of Cyn d 24 has identified the involvement of a novel class of ... AGAD AADA.NA.VG D. D 113 Zea AYA.S A- QRQG LI GG FW AGAD.SASDA.GS.VS QY.DHDT.S 112 Nicotiana AYA.N S-Q.AA NL HGQ AE -GDFMTAAKA.EM.V QY.DHD 118 Cyn d 24 DQGKM...

Ngày tải lên: 07/03/2014, 12:20

10 665 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature...

Ngày tải lên: 08/03/2014, 08:20

13 492 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...

Ngày tải lên: 16/03/2014, 00:20

9 491 0
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

... like the Trp residue of the 183 Conformation, ligand binding and distribution of nematode protein Ag-NPA-1 R Jordanova et al Fig Immunohistological localization of Ag-NPA-1 in adult A galli and ... ligand binding and distribution of nematode protein Ag-NPA-1 Fig Immunogold electron microscopic localization of Ag-NPA-1 in a male A galli worm (A) Sect...

Ngày tải lên: 16/03/2014, 18:20

10 501 0
Báo cáo khoa học: Cellular and molecular action of the mitogenic protein-deamidating toxin from Pasteurella multocida pptx

Báo cáo khoa học: Cellular and molecular action of the mitogenic protein-deamidating toxin from Pasteurella multocida pptx

... catalyze the same deamidating reaction on related Molecular action of Pasteurella multocida toxin G-protein targets and with overlapping cellular outcomes, the sequence and structure of the activity ... current understanding of the structure–function, mechanism of action and cellular consequences of this newest member of the G -protein-deamidating...

Ngày tải lên: 22/03/2014, 15:21

17 403 0
Báo cáo khoa học: Site-directed mutagenesis and footprinting analysis of the interaction of the sunflower KNOX protein HAKN1 with DNA ppt

Báo cáo khoa học: Site-directed mutagenesis and footprinting analysis of the interaction of the sunflower KNOX protein HAKN1 with DNA ppt

... achieved The combination of these experiments with the footprinting results and previous 197 KNOX homeodomain DNA interactions A B Fig A model for the interaction of HAKN1 with DNA (A) Diagram of the ... this study, we investigated the interaction of the homeodomain of the KNOX protein HAKN1 with DNA As no structural studies on the inter...

Ngày tải lên: 23/03/2014, 13:20

13 558 0
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...

Ngày tải lên: 30/03/2014, 11:20

13 455 0
Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx

Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx

... hypoxanthineguanine phosphoribosyltransferase (hprt) locus of lymphocytes isolated from spleens of mice following exposure to ozone, NNK, and DBP, and combined treatments of NNK and DBP on ozone for 32- ... Molecular analysis of hprt mutation 383 Table DNA sequence analysis of hprt mutant in splenic cells of B6C3F1 male mice in 52- wk study Typ...

Ngày tải lên: 07/08/2014, 18:20

7 397 0
Báo cáo y học: " Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia" potx

Báo cáo y học: " Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia" potx

... al.: Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia Virology Journal 2010 7:302 Submit your next manuscript to BioMed Central and take full advantage of: ... NH and OB conceived of the study, participated in its design, and in drafting the manuscript HT and JB participated in the study design and coor...

Ngày tải lên: 12/08/2014, 02:20

6 412 0
Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

... GTCCACATCAACGGCCGCCGGCTCG AGCCAACAGACACTCCTGTGTTCC CATGCCAGACCCTGATATTATCACC ACCTACACCAATGTCACCTGGAC GTGCCACACCTACTATGACCACAG TCAAGCCTCCAAACCAAGCC TGGCGGTCCATAAATGAGGTG TATGCAGCTTTGGCAATTCCC TTGATCTTTAGCAACTGTATCTG ... TGGTGGAGGCCTGTTCAGAGC CCAAGTTGTGGGCTGTCAACAC CAGAGTCCTCCTGGTGGACATTC ATTACCAAGCGCAACGCTAGGC CATGTGGCCAACATGTGTG TGATTTGGTCAAGGTAGCC CCTTCTACAACACCAAATGATTGCC AGGCCAGGATGTCAACAC...

Ngày tải lên: 12/08/2014, 04:21

10 401 0
Báo cáo y học: "A systematic comparative and structural analysis of protein phosphorylation sites based on the mtcPTM database" ppt

Báo cáo y học: "A systematic comparative and structural analysis of protein phosphorylation sites based on the mtcPTM database" ppt

... residues, the other of tyrosines This grouping is based on the similar characteristics of serine and threonine, and the fact that they are usually targeted by the same protein kinases The study focused ... identity cut-off (>30%) very few sites were highly conserved (Figure 7a) Only less than 5% of the sites were strictly conserved across the alignments, and...

Ngày tải lên: 14/08/2014, 07:21

20 296 0
Expressed sequence tags analysis of major allergens producing dust mites and molecular characterization of their allergens

Expressed sequence tags analysis of major allergens producing dust mites and molecular characterization of their allergens

... www.pdffactory.com List of Tables IgE binding rates of the cloned dust mite allergens and their biological properties 22 Overview of the productions of recombinant mite allergens: from the aspects of the production ... mutants of the mites FABP homologues 70 Overview of the characteristics and statistical data of the dust mites EST collections 80 Summary and...

Ngày tải lên: 12/09/2015, 11:08

312 4K 0
Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

... mouse, Fugu, and zebrafish 63 -64 3.5 Assembled sequences of irf6 genomic fragments 64 -66 3 .6 The irf6 gene locus on the LG22 in T51 RH panel and in the Ensembl zebrafish version (ZV6) 68 -69 3.7 Whole-mount ... morpholinos 85 3.14 Loss of irf6 function phenotypes 86- 87 3.15 Comparison of expression of molecular markers in irf6 morphants and wildtype 91-92 3...

Ngày tải lên: 14/09/2015, 12:44

149 297 0
w