Engineering and characterization of human renal proximal tubular cells for applications in vitro toxicology and bioartifical kidneys
... proximal tubular cells of human origin Therefore, human primary renal proximal tubular cells (HPTC) would be most suitable for such applications However, the application of primary human cells is ... effects on renal cells and possible applications will be discussed in detail 23 1.3 Genetic Engineering of HPTC and development of a BMP-7-producin...
Ngày tải lên: 09/09/2015, 10:19
... of human embryonic stem cells Stem cells 2005, 23:1228-1233 Moon SY, Park YB, Kim D-S, Oh SK, Kim D-W: Generation, culture, and differentiation of human embryonic stem cells for therapeutic applications ... Daley GQ: Therapeutic potential of embryonic stem cells Blood Rev 2005, 19:321-331 Menendez P, Wang L, Bhatia M: Genetic manipulation of human embr...
Ngày tải lên: 13/08/2014, 09:21
... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocyt...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo sinh học: "Human cytokine-induced killer cells have enhanced in vitro cytolytic activity via non-viral interleukin-2 gene transfer" docx
... secreting lymphocytes functioning as immune enhancer cells Therefore, our report is the first describing CIK cells to have enhanced in vitro cytolytic activity via non-viral interleukin-2 gene ... by stimulating immune cells including T and natural killer cells But adenoviral transfection may raise safety questions in human gene therapy Therefore, we were int...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx
... hMnSOD has a low level of product inhibition, similar to that of the parent mutant Q143A hMnSOD, while exhibiting higher catalytic activity and efficiency Although even higher catalytic activity would ... efficiency and similarly low product inhibition compared with the Q143A hMnSOD parent Our results demonstrate the ability of directed evolution to engineer variants...
Ngày tải lên: 07/03/2014, 11:20
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt
... Mapping of transcription initiation sites in the human DNASE1 gene To identify the transcription initiation sites of DNASE1 in pancreas, 5¢-RACE based on RNA ligasemediated and oligo-capping ... including characterization of the promoter region of the gene and the associated transcriptional factors Therefore, delineation of the transcriptional Promot...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx
... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human A...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt
... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Fur...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc
... volume and energetic properties of the binding of CO to hemoproteins Biophys J 66, 89–98 Tuckey RC & Kamin H (1983) Kinetics of O2 and CO Binding to adrenal cytochrome P-450scc Effect of cholesterol, ... was in the range of values determined in previous studies for the interaction between bovine Adx and bCYP11B1 Biacore measurements were performed to investigate the bindin...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx
... this article as: Lechner et al.: Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse ... serum and regulated by association of a latency protein, precluded clear neutralization data Characterization of human CD33+ and CD1...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot
... concentration of DHPC Protein -lipid interactions and Protein-LDLR binding of ApoE- (72-166) Proteins To identify and compare the lipid binding ability of the three apoE- (72-166) peptides, we assessed ... Received: 17 September 2010 Accepted: 10 January 2011 Published: 10 January 2011 References Weisgraber KH, Rall SC Jr, Mahley RW: Human E apoprotein heterogeneity Cysteine...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Characterization of human adenovirus 35 and derivation of complex vectors" doc
... progeny yields of Ad35 vectors on 293-ORF6 cells rAd35 vector Ad35 wt Yield (pu/cell) 125,893 Ad35E1(d8) 77,839 Ad35E1(d8)E4(AN) 58,875 Ad35E1(d8)E3(HE)E4(AN 36,000 To further expand the utility of ... Replication-deficient human adenovirus type 35 vectors for gene transfer and vaccination: efficient human cell infection and bypass of preexisting adenovirus immunity Journa...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: "Phenotypic and genotypic characterization of Human Immunodeficiency Virus type 1 CRF07_BC strains circulating in the Xinjiang Province of China" pot
... safety [11 ] The present study aims to characterize the genotype and phenotype of HIV -1 CRF07_BC strains circulating in Xinjiang province, in comparison with those of the subtype B' predominating in ... BC V1V2 20 B’ V1V2 V1-V5 in gp120 of subtype B’ and CRF07_BC Figure gp120 of the CRF07_BC and subtype B' viruses The frequency of potential N-l...
Ngày tải lên: 12/08/2014, 23:21