A site specific design of a fixed pitch fixed speed wind turbine blade with multiple airfoils as design variable

A site specific design of a fixed pitch fixed speed wind turbine blade with multiple airfoils as design variable

A site specific design of a fixed pitch fixed speed wind turbine blade with multiple airfoils as design variable

... Models of lift and drag coefficients of stalled and unstalled airfoils in wind turbines and wind tunnels National Aeronautics and Space Administration, NASA/CR-2008-215434 (2008) National Oceanic and ... using aerofoil and blade properties as design variables Renewable Energy 62 (2014) 506-515 R Lanzafame, M Messina, Design and performance of a double -pitch wind tur...

Ngày tải lên: 09/09/2015, 10:17

12 347 0
DC bus control of variable speed wind turbine using a buck boost converter

DC bus control of variable speed wind turbine using a buck boost converter

... Hydro-Québec, Natural Resources Canada and the Natural Sciences and Engineering Research Council of Canada VII [1] REFERENCES C.L Kana; M Thamodharan and A Wolf; “System management of a wind- energy converter , ... a buck boost converter inserted between the rectifier output and the DC bus The control relationship between generator speed and the DC bus voltage is...

Ngày tải lên: 03/01/2014, 19:15

5 576 1
báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

... and plateau, and cut to match the surface area of the condyle The areas of India ink staining were outlined using a permanent marker Tracings of the India ink-stained tibial and femoral condyles ... assessments The lamina splendens was not disrupted in any location based on lack of India ink staining, indicat- ing that AC surface integrity was maintained for two weeks i...

Ngày tải lên: 20/06/2014, 00:20

12 522 0
báo cáo khoa học: " Intein-mediated site-specific conjugation of Quantum Dots to proteins in vivo" pdf

báo cáo khoa học: " Intein-mediated site-specific conjugation of Quantum Dots to proteins in vivo" pdf

... of QD's to Akt-PH-EGFP via intein mediated protein splicing In vivo conjugation of QD's to Akt-PH-EGFP via intein mediated protein splicing (a) Schematic representation of site-specific intein-mediated ... half of the intein (IC) was biotinylated and conjugated in vitro to streptavidin-coated QD's The RNA's encoding Akt-PH -IN or Btk-PH -IN were delivered into Xenopu...

Ngày tải lên: 11/08/2014, 00:22

9 203 0
báo cáo khoa học: "Split-Inteins for Simultaneous, site-specific conjugation of Quantum Dots to multiple protein targets In vivo" pptx

báo cáo khoa học: "Split-Inteins for Simultaneous, site-specific conjugation of Quantum Dots to multiple protein targets In vivo" pptx

... DnaB mini intein-mediated conjugation of QDs to the N-terminus of mem-EGFP homology domain of Akt Using this methodology we were able to site-specifically tag a protein domain with QDs in vivo for ... Complexes following in vivo, intein-mediated conjugation to the Cterminus of paxillin We have recently used intein based conjugation to covalently conjugate QDs to...

Ngày tải lên: 11/08/2014, 00:23

14 290 0
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

... TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT ... P3F P3R GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experim...

Ngày tải lên: 23/03/2014, 04:21

12 462 0
Báo cáo y học: "Close relationship of tissue plasminogen activator–plasminogen activator inhibitor-1 complex with multiple organ dysfunction syndrome investigated by means of the artificial pancreas" doc

Báo cáo y học: "Close relationship of tissue plasminogen activator–plasminogen activator inhibitor-1 complex with multiple organ dysfunction syndrome investigated by means of the artificial pancreas" doc

... related to the origin of the parameters PAI-1 is synthesized not only by the endothelium, but also by the liver, vascular smooth muscle cells, and platelets [46] AT-III is synthesized by the liver ... and endothelium, and protein C by the liver On the contrary, the tPA–PAI-1 complex is considered to be synthesized mainly by the activated endothelium, because t...

Ngày tải lên: 12/08/2014, 18:20

12 204 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its tar...

Ngày tải lên: 20/02/2014, 11:20

10 639 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

... E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic activity about twice that of wild-type E1 ... reaction mixture with E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation...

Ngày tải lên: 20/02/2014, 23:20

10 459 0
Determinants of General Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany doc

Determinants of General Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany doc

... Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany Christian Wegner and Marc Luy Introduction In general, the health status at old ... Health Status good health status Disease Status good health status absence of disease absence of disease died loss bad health sta...

Ngày tải lên: 22/03/2014, 13:20

61 545 0
Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx

Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx

... this binding event was greater than 30 lM In this case the exact Kd value was not assessed by Scatchard analysis because the highest SOCS-3 concentration was 30 lM and a calculation by the BIAEVALUATION ... affinity by providing an additional contact with the SH2 domain of SOCS-3 involving R94 A conformational change induced by the phosphorylation of tyrosine Y4 31 may a...

Ngày tải lên: 24/03/2014, 00:21

11 579 0
Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term. potx

Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term. potx

... Gross Rate is the daily interest accrual rate AER (Annual Equivalent Rate) illustrates what the interest would be if interest was paid and compounded each year Our Annual Equivalent Rate (AER) calculation ... was paid and compounded each year Our AER calculation assumes that the account is held for a year and that the interest rate remains constant Deposit Interest...

Ngày tải lên: 29/03/2014, 01:20

5 433 0
Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

... view of focus of attention a word is treated as having a static semantics However metaphor can make the semantic type of objects more flexible By using a verb that only applies to humans, as above, ... terms of a moving vehicle at the same time emphasizing the effort that it takes to leave (as in section 3.3) A party can be described, via "is -a" links of the abstraction h...

Ngày tải lên: 31/03/2014, 06:20

3 267 0
báo cáo hóa học: " Measuring disease-specific quality of life in rare populations: a practical approach to cross-cultural translation" potx

báo cáo hóa học: " Measuring disease-specific quality of life in rare populations: a practical approach to cross-cultural translation" potx

... Table 1: A comparison of cross-cultural adaptations of quality of life measures (Continued) Total number of formal translations At least forward and back translations At least forward translations ... Backward Translation A qualified professional translator (affiliated with a commercial translating service in Canada) performed a single backward translation into the ori...

Ngày tải lên: 18/06/2014, 19:20

8 474 0
báo cáo hóa học: " Validation of a Chinese version of disease specific quality of life scale (HFS-36) for hemifacial spasm in Taiwan" docx

báo cáo hóa học: " Validation of a Chinese version of disease specific quality of life scale (HFS-36) for hemifacial spasm in Taiwan" docx

... HFS-36 scale was more sensitive and specific to evaluate the HRQoL in HFS Abbreviations HRQoL: Health-related Quality of Life; HFS: Hemifacial Spasm; ADL: Activities of Daily Living; BTX: Botulinum ... Health and Quality of Life Outcomes 2009, 7:104 Introduction Hemifacial spasm (HFS) is characterized by involuntary contractions of the facial muscles innervated by...

Ngày tải lên: 18/06/2014, 19:20

8 601 0
w