Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation

... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacter...

Ngày tải lên: 09/09/2015, 10:08

... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGG...

Ngày tải lên: 16/10/2015, 11:57

... al.: Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia Virology Journal 2010 7:302 Submit your next manuscript to BioMed Central and take full advantage of: ... NH and OB conceived of the study, participated in its design, and in drafting the manuscript HT and JB participated in the study design and coor...

Ngày tải lên: 12/08/2014, 02:20

... LIVE- TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM- MEDIATED TRANSFORMATION LI XIAOYANG (B Sc Science.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Comparison of transient transformation, stable transformation and VirE2 delivery in AMT of yeast 67 IX LIST OF FIGURES Figure 3.1 Possible roles of...

Ngày tải lên: 09/09/2015, 11:19

... in e A III LV E B dc dc e vtw vtw E C vt dt D Fig Thickness of Ventral Telencephalon Wall (µm) 300 250 * 200 150 100 50 Fig Control Diabetic vt dt vt vt A B Fig % of BrdU-cells in Ventral ... vt B e A Fold of induction 3.5 ** 2.5 1.5 0.5 Control Diabetic B 333bp C Fig dc dc III vt A vt B LV A Fig dc e dc III vt vt LV A Fig dt B III e e e dc vt LV A Fig 10 B A Fold of induction 1.5...

Ngày tải lên: 26/11/2015, 12:46

... underlying mechanisms of gene silencing and related silencing responses Virus- encoded gene silencing suppressors offered an excellent tool for dissection of the gene silencing process Gene silencing suppressors ... 1.1 Gene silencing 1.1.1 Discovery of gene silencing 1.1.2 Induction of gene silencing 1.1.3 Mechanisms of gene silencing 1.1.4 Sys...

Ngày tải lên: 16/09/2015, 08:31

... silencing by microRNAs is highly conserved in plants and specifically targets all of the HD-Zip III genes through the binding of mir165/166 [19] Functional analyses of HD-Zip III genes in herbaceous ... redundancy The aim of this study was to develop insights into the role of HD-Zip III genes in secondary xylem formation in forest trees We examined th...

Ngày tải lên: 11/08/2014, 11:21

... BnWRKY65 BnWRKY35 BnWRKY27 BnWRKY22 BnWRKY29 BnWRKY21 BnWRKY39 BnWRKY74 BnWRKY15 BnWRKY7 BnWRKY17 BnWRKY11 BnWRKY18 BnWRKY40 BnWRKY72 BnWRKY36 BnWRKY42 BnWRKY6 BnWRKY31 BnWRKY1N BnWRKY20N BnWRKY4N ... BnWRKY24 BnWRKY56 BnWRKY75 BnWRKY45 BnWRKY8 BnWRKY28 BnWRKY50 BnWRKY51 BnWRKY10 BnWRKY4C BnWRKY3C BnWRKY25C BnWRKY44C BnWRKY20C BnWRKY33C BnWRKY2C BnWRKY26C BnWRKY34C BnWRKY32C BnWRKY1C BnWRKY69...

Ngày tải lên: 12/08/2014, 03:20

... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the ... The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic compone...

Ngày tải lên: 13/10/2015, 16:50

... analysis of Lsm1 p showing the importance of residues proposed to be involved in RNA binding and complex formation, and of the C-terminal region for the func- Lsm1 and -8 domains involved in localization ... N- and ⁄ or C-terminal domains, exchanged the central Sm domains or, in the case of Lsm8 p, made point mutations in putative RNA-binding r...

Ngày tải lên: 07/03/2014, 02:20

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...

Ngày tải lên: 30/03/2014, 11:20

... loading Results BPA induces dose dependent apoptosis in acute myeloid leukemia cells To understand the potential role of BPA in biological systems of leukemias we tested the action of BPA in three ... activity of these compounds [17,18] In the present manuscript, we decided to investigate the effects of different doses of BPA on acute myeloid l...

Ngày tải lên: 18/06/2014, 15:20

Ngày tải lên: 07/08/2014, 17:22

... Agrobacterium is to successfully and stably transfect of plant tissue post TDNA translocation it is important that, the T- DNA be protected from nuclease activity, the T- DNA be transported to the nucleus ... attachment motif similar to that of vitronectin (Swart et al 1994) This glycoprotein is thought to be involved in the first direct attachment of the bacteria to plant cells...

Ngày tải lên: 12/09/2015, 08:20

... attainable size, big and long fins of the RG1 and the intense colouration of the MG One of the shortfalls of the hybrid is the large variation of phenotypes produced in their offsprings which is common ... particularly the subfamily Osteoglossinae We hope that our work will enhance the understanding of the evolution of the breeding biology of teleost, a...

Ngày tải lên: 14/09/2015, 08:49