Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation
Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation
... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacterium as an invader initiates the ... that mutagenesis of the dynein-interacting motifs of viral proteins caused non-infective viruses (Merino-Gracia et al., 2011) 1.1.5 The exploitation of microtubules by Agrobacterium? The molecular...
- 208
- 200
- 0
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC ... establish the link between potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in...
- 109
- 382
- 0
Báo cáo y học: " Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia" potx
... al.: Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia Virology Journal 2010 7:302 Submit your next manuscript to BioMed Central and take full advantage of: ... NH and OB conceived of the study, participated in its design, and in drafting the manuscript HT and JB participated in the study design and coordination and in discussing manuscript NH, NBF and ... suggested the predominance of this new subgenotype in the region [23,28] Subgenotype D1 is Page of predominant in the Eastern part of Africa; Saudy et al described it in Egypt [29] Our region geographically...
- 6
- 412
- 0
LIVE TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM MEDIATED TRANSFORMATION
... LIVE- TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM- MEDIATED TRANSFORMATION LI XIAOYANG (B Sc Science.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Comparison of transient transformation, stable transformation and VirE2 delivery in AMT of yeast 67 IX LIST OF FIGURES Figure 3.1 Possible roles of VirE2 in Agrobacterium- mediated transformation ... Agrobacterium VirE2 protein in yeast cells 50 3.5 Study of Agrobacterium- delivered VirE2 in yeast cells 51 3.5.1 Construction of Agrobacterium VirE2 labeling mutants 53 3.5.2 Virulence assay of...
- 147
- 439
- 0
Molecular analysis of maternal diabetes induced changes in the developing neural tube
... in e A III LV E B dc dc e vtw vtw E C vt dt D Fig Thickness of Ventral Telencephalon Wall (µm) 300 250 * 200 150 100 50 Fig Control Diabetic vt dt vt vt A B Fig % of BrdU-cells in Ventral ... vt B e A Fold of induction 3.5 ** 2.5 1.5 0.5 Control Diabetic B 333bp C Fig dc dc III vt A vt B LV A Fig dc e dc III vt vt LV A Fig dt B III e e e dc vt LV A Fig 10 B A Fold of induction 1.5 ... TGF-ß l TGF-ß l III III E F TNF-α III G Fig 17 TNF-α G III H Lectin TGF-ß1 A B C Lectin TNF-α III D Fig 18 TGF-ß1+Lectin TNF-α+Lectin III III E F tm III htms III htm A Fig 19 B 50 Mean Cell numbers/mm...
- 19
- 180
- 0
Molecular analysis of hibiscus chlorotic ringspot virus coat protein mediated suppression of gene silencing
... underlying mechanisms of gene silencing and related silencing responses Virus- encoded gene silencing suppressors offered an excellent tool for dissection of the gene silencing process Gene silencing suppressors ... 1.1 Gene silencing 1.1.1 Discovery of gene silencing 1.1.2 Induction of gene silencing 1.1.3 Mechanisms of gene silencing 1.1.4 Systemic silencing ... 1.2.4 Molecular basis of silencing suppression Although many gene silencing suppressors have been found, there is little knowledge of how these gene silencing suppressors inhibit the gene silencing...
- 187
- 286
- 0
báo cáo khoa học: "Gene family structure, expression and functional analysis of HD-Zip III genes in angiosperm and gymnosperm forest trees" pps
... silencing by microRNAs is highly conserved in plants and specifically targets all of the HD-Zip III genes through the binding of mir165/166 [19] Functional analyses of HD-Zip III genes in herbaceous ... redundancy The aim of this study was to develop insights into the role of HD-Zip III genes in secondary xylem formation in forest trees We examined the HDZip III gene family in two unrelated tree ... neofunctionalisation or subfunctionalisation within the angiosperms Transcription profiles identify HD-Zip III putatively involved in vascular development Delineating the potential role of HD-Zip...
- 17
- 261
- 0
báo cáo khoa học: " Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments" ppt
... BnWRKY65 BnWRKY35 BnWRKY27 BnWRKY22 BnWRKY29 BnWRKY21 BnWRKY39 BnWRKY74 BnWRKY15 BnWRKY7 BnWRKY17 BnWRKY11 BnWRKY18 BnWRKY40 BnWRKY72 BnWRKY36 BnWRKY42 BnWRKY6 BnWRKY31 BnWRKY1N BnWRKY20N BnWRKY4N ... BnWRKY24 BnWRKY56 BnWRKY75 BnWRKY45 BnWRKY8 BnWRKY28 BnWRKY50 BnWRKY51 BnWRKY10 BnWRKY4C BnWRKY3C BnWRKY25C BnWRKY44C BnWRKY20C BnWRKY33C BnWRKY2C BnWRKY26C BnWRKY34C BnWRKY32C BnWRKY1C BnWRKY69 ... Figure Expression analyses of BnWRKY genes in response to fungal challenge Expression analyses of BnWRKY genes in response to fungal challenge Changes in BnWRKY transcript abundance in response to...
- 19
- 381
- 0
Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells
... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the ... The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic components of Agrobacterium The T- DNA, vir genes ... course analysis of T- DNA accumulation inside the wild type and las17 yeast cells 46 3.5 Detection of individual T- DNA molecules inside the yeast cells 50 3.5.1 Percentage of yeast cells with T- DNA...
- 74
- 210
- 0
Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt
... analysis of Lsm1 p showing the importance of residues proposed to be involved in RNA binding and complex formation, and of the C-terminal region for the func- Lsm1 and -8 domains involved in localization ... N- and ⁄ or C-terminal domains, exchanged the central Sm domains or, in the case of Lsm8 p, made point mutations in putative RNA-binding residues We investigated the cellular localization of GFPtagged ... in 5–20% of cells under stress conditions (Fig 5B), suggesting that the N-terminal domain of Lsm1 p is sufficient in combination with the Sm and C-terminal domains of Lsm8 p (i.e presumably in the...
- 16
- 515
- 0
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were performed with GST -C2 domain fusion ... (0–0.5 m) at a flow rate of 1.0 mLÆmin)1 The wildtype and mutated forms of recombinant cardosin A were autoactivated and assayed for activity as described by Castanheira et al [34] Binding assays In...
- 13
- 455
- 0
báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx
... loading Results BPA induces dose dependent apoptosis in acute myeloid leukemia cells To understand the potential role of BPA in biological systems of leukemias we tested the action of BPA in three ... activity of these compounds [17,18] In the present manuscript, we decided to investigate the effects of different doses of BPA on acute myeloid leukemia models to understand the mechanism(s) of BPA ... at the present, our data suggest that the contact or the assumption of BPA might increase the effects of a on-going treatment in humans, apart, of course, having effects on its own Finally, the...
- 8
- 603
- 0
Molecular analysis of genes mediating t DNA trafficking inside yeast cells
... Agrobacterium is to successfully and stably transfect of plant tissue post TDNA translocation it is important that, the T- DNA be protected from nuclease activity, the T- DNA be transported to the nucleus ... attachment motif similar to that of vitronectin (Swart et al 1994) This glycoprotein is thought to be involved in the first direct attachment of the bacteria to plant cells and is mediated by the ... resulting tumors that arise from transfection with this mutant strain contain relatively intact 5’ ends in the integrated TDNA suggesting the accuracy of integration is maintained despite the...
- 251
- 221
- 0
Molecular analysis of the breeding biology of the asian arowana (scleropages formosus)
... attainable size, big and long fins of the RG1 and the intense colouration of the MG One of the shortfalls of the hybrid is the large variation of phenotypes produced in their offsprings which is common ... particularly the subfamily Osteoglossinae We hope that our work will enhance the understanding of the evolution of the breeding biology of teleost, and provide a genetic glimpse into the biology of ancient ... 4.3 The advantages of being able to sex the adult Asian arowanas 132 4.4 The change in the breeding relationships in a pond after the death of a highly productive male indicates the presence of...
- 184
- 327
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ