Optimization of chitin and chitosan extraction from by product from white leg shrimp (penaeus vannamei) industry in vietnam to improve its quality and efficiency
Optimization of chitin and chitosan extraction from by product from white leg shrimp (penaeus vannamei) industry in vietnam to improve its quality and efficiency
... recovering chitin and protein hydrolysates from white leg shrimp shells with pepsin In addition, the information relevent to kinetics of the process and the linkage between protein, minerals and chitin ... Chitin Figure 3.39: Proposed procedue for recovering chitin and protein from heads of white leg shrimp Chitin Figure 3.40: Proposed procedue for recovering chitin and protein from shells of white ... technology which were integrated by physical, enzymatic and chemical methods allowed to innovate the production of chitin and chitosan from by- products of the manufacturing white leg shrimp The procedues...
- 24
- 1,037
- 1
ẢNH HƯỞNG CỦA ĐỘ KIỀM LÊN QUÁ TRÌNH TĂNG TRƯỞNG CỦA TÔM THẺ CHÂN TRẮNG (Penaeus vannamei) ĐƯỢC NUÔI Ở ĐỘ MẶN THẤP (4‰) EFFECT OF ALKALINITY ON GROWTH PERFORMANCE OF WHITE LEG SHRIMP (Peneaus vannamei) CULTURED IN LOW SALINITY AREA (4‰)
... giống Tăng Trưởng, Tỉ lệ Sống Và Hiệu Quả Sử Dụng Thức Ăn Của Tôm Để đánh giá ảnh hưởng độ kiềm lên tốc độ tăng trưởng tôm thẻ chân trắng nuôi nồng độ mặn thấp (4‰), số tiêu tăng trưởng tôm tiến ... Thí nghiệm 2: Đánh giá ảnh hưởng độ kiềm lên trình tăng trưởng, hiệu sử dụng thức ăn tỉ lệ sống tôm thẻ chân trắng nuôi độ mặn thấp (4‰) Tôm hóa độ mặn thấp (4‰), sau tuần tôm đạt kích cỡ 2cm nặng ... kiềm thấp, ảnh hưởng đến tăng trưởng tôm Do đó, tiến hành thử nghiệm để đánh giá ảnh hưởng độ 108 kiềm lên tăng trưởng, hiệu sử dụng thức ăn tỉ lệ sống tôm thẻ chân trắng nuôi độ mặn thấp (4‰) Kết...
- 9
- 1,127
- 8
effects of light intensity on formation of bioflocs, water quality, growth performanceof white leg shrimp (litopenaeus vannamei) postlarvae in super intensive rearing tank
... The thesis Effects of light intensity on formation of bioflocs, water quality, growth performance of white leg shrimp (litopenaeus vannamei) postlarvae in super intensive rearing tank defended ... COLLEGE OF AQUACULTURE AND FISHERIES EFFECTS OF LIGHT INTENSITY ON FORMATION OF BIOFLOCS, WATER QUALITY, GROWTH PERFORMANCE OF WHITE LEG SHRIMP (Litopenaeus vannamei) POSTLARVAE IN ... composition of bioflocs, rearing water quality, growth rates, survival rates and yields of white leg shrimp under different light intensities is main purposes of this study Results of the study can contribute...
- 26
- 450
- 0
effects of chitosan on flocculation of chaetoceros algae and ability to apply on blood cockle (anadara granosa) and white leg shrimp (litopenaeus vannamei) rearing
... COLLEGE OF AQUACULTURE AND FISHERIES EFFECTS OF CHITOSAN ON FLOCCULATION OF CHAETOCEROS ALGAE AND ABILITY TO APPLY ON BLOOD COCKLE (Anadara granosa) AND WHITE LEG SHRIMP (Litopenaeus vannamei) REARING ... EFFECTS OF CHITOSAN ON FLOCCULATION OF CHAETOCEROS ALGAE AND ABILITY TO APPLY FOR REARING BLOOD COCKLE (Anadara granosa) AND WHITE LEG SHRIMP (Litopenaeus vannamei) Pham Thi Hong Ai College of Aquaculture ... out to test the effectiveness of chitosan as a flocculant on flocculation of Chaetoceros algae and ability to apply on white leg shrimp (Litopenaeus vannamei) and blood cockle (Andara granosa) rearing...
- 15
- 370
- 0
super intensive culture of white leg shrimp (litopenaeus vannamei), in recirculating tank system at different stocking densities
... CAN THO UNIVERSITY COLLEGE OF AQUACULTURE AND FISHERIES SUPER INTENSIVE CULTURE OF WHITE LEG SHRIMP (Litopenaeus vannamei), IN RECIRCULATING TANK SYSTEM AT DIFFERENT STOCKING DENSITIES BY LE PHUOC ... 2.2 .White leg shrimp (Litopenaeus vannamei) production in the world 2.3 .White leg shrimp (Litopenaeus vannamei) production in Viet Nam 2.4.Application of recirculating water system in white shrimp ... topic Super intensive culture of white shrimp (Litopenaeus vannamei), in a water circulation system at different stocking densities is needed to determine the sensible density and the growth rate...
- 50
- 788
- 1
the effects of probiotics on quality postlavae of white leg shrimp (litopenaeus vannamei)
... Vietnam The practice of white leg shrimp culture is gaining popularity in most areas of Vietnam Within the overall agro-fishery-based economy of the country, the contribution of white leg shrimp ... choose to produce shrimp seed with most effective economic in practical, therefore research on seed production such as “ The effects of probiotics on quality of Postlavae of white leg shrimp “ is really ... out the appropriate probiotics supply to improve production efficiency and quality of Postlavae of white leg shrimp (Litopenaeus vannamei) 1.3 Research content The effects of using difference probiotics...
- 41
- 483
- 0
Optimization Of Factors Affecting Syrup Production From Sim Fruit (Rhodomyrtus Tomentosa) For High Anthocyanin Concentration And Good Quality
... temperature/time/enzyme concentration for extraction of anthocyanin from Sim, and to optimize pasteurization for good quality of Sim syrup High sugar content in the sim syrup is usepful to enhance the shelf-life of ... 0.07 Anthocyanin (mg) 75.46 ± 0.73 101 Optimization of factors to affect syrup production from "sim" fruit (Thodomyrtus tomentosa) (Mang Den, Kontum) for high anthocyanin concentration and good quality ... counts 105 Optimization of factors to affect syrup production from "sim" fruit (Thodomyrtus tomentosa) (Mang Den, Kontum) for high anthocyanin concentration and good quality 3.3.2 Effects of pasteurization...
- 10
- 523
- 1
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... performance and thermal characteristics of the system Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar desalination system is a combination of ... Results and discussion There are many design and operating parameters which affect the performance characteristics and distillate yield of the multi-stage evacuated desalination system These parameters ... Conclusion A transient mathematical model was developed for the flat plate collector and the multi-stage evacuated solar desalination system to evaluate the optimum design configuration and system...
- 26
- 568
- 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf
... control of 30 s at 95 °C, 30 s at 50 °C and at 72 °C with a preheat at 95 °C and a 10 final extension at 72 °C using primers, S1 (5¢-GCAAATGCAACTGGA AGCGG-3¢) and A1 (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) ... (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢) and A2 (5¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification of HRT2 The PCR products were analyzed by agarose gel electrophoresis ... AAM92890), AAM92881, AAM92879, BAB92023 (AAM92883, AAM92884, AAM92885, AAM92887, AAM92888), BAB92024 and AAM92882 (AAM92886) (submitted to GenbankTM and DDBJ by Coldren et al and Sando et al respectively)...
- 10
- 516
- 0
Báo cáo hóa học: "OPTIMIZATION OF DISCRETE AND DIFFERENTIAL INCLUSIONS OF GOURSAT-DARBOUX TYPE WITH STATE CONSTRAINTS" pdf
... Optimization of Darboux inclusions Now, after simple transformations of first double integral over Q of right-hand side of inequality (5.8) using equality of mixed partial derivatives of x∗ (t,τ) ... Control of Nonconvex Discrete and Differential Inclusions, Sociedad Matematica Mexicana, Mexico, 1998 , Optimal control of difference, differential, and differential-difference inclusions, Journal [17] of ... sorbtion, and dissorbtion of gases can be reduced to this formulation Needed facts and problem statement Let Rn be n-dimensional Euclidean space and let P(Rn ) be the set of all nonempty subsets of...
- 16
- 256
- 0
Process optimization of ultrasound assisted curcumin nanoemulsions stabilized by OSA modified starch
... the detailed study of starch -stabilized nanoemulsions [48] Conclusions Ultrasound- assisted nanoemulsions were prepared and stabilized successfully by OSA- starches Although, nanoemulsions were ... stabilized nanoemulsions (Fig 5b) 3.6 Size stability of loaded nanoemulsions and foam formation of coarse emulsions One month storage at 25 °C for all three types of OSA- starchstabilized nanoemulsions ... curcumin- loaded nanoemulsions stabilized by OSA- starch using high-intensity ultrasonic homogenization Materials and methods 2.1 Materials Curcumin (77.90% pure, with 16.11% of demethoxycurcumin and 1.85% of...
- 10
- 569
- 0
Báo cáo sinh học: "Genotype by environment interaction for adult body weights of shrimp Penaeus vannamei when grown at low and high densities" ppt
... symbol for a direct product In addition, define el and Genotype by density interaction in shrimp 547 Table I Means for BW (and SD) of P vannamei male and female adult shrimp when grown at low vs high ... variance for shrimp in the high density h environment, rlh is the additive genetic covariance across the low and high density environments, A is the numerator relationship matrix among all shrimp, and ... analysis of heritabilities of P vannamei shrimp BW at adult, mature age, after growing 102 replicated genotypes (families) at two grow-out density conditions, and an estimate of the genetic correlation...
- 11
- 288
- 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...
- 144
- 306
- 0
Environmental regulation and economic competitiveness: Evidence from the textile industry in Vietnam
... impacts The thesis would bring some insights into the environmental legal regulation in Vietnam and the impacts they have on the industry I.1 Research questions The thesis aims to answer the following ... of environment within the Vietnam textile industry - Collecting and studying the Vietnamese environmental policies and standards, especially those applying to the industry The search began with ... for the industrial pollution control III.2 The textile industry in Vietnam III.2.1 Overview of textile- garment industry In Vietnam, Textile- Garment industry is of pivotal value in the overall industrialization...
- 50
- 602
- 1
Báo cáo Y học: Formation of conjugated D11 D13-double bonds by D12-linoleic acid (1,4)-acyl-lipid-desaturase in pomegranate seeds doc
... conjutrienoic fatty acids biosynthetic pathway of unusual fatty acids in seeds [18], since many of these functional groups are introduced into the fatty acid backbone while the fatty acid is esterified ... different linolenic acid isomers is determined Plant oils containing conjugated linolenic acid derivatives are of commercial interest, since they are used as drying oils in paints Thus seed oils may be ... preference against linoleic acid in the presence of a-linolenic acid This problem may be solved by using this new type of (1,4)-acyl-lipid-desaturase that converts a double bond located only in the...
- 8
- 328
- 0
Từ khóa: biomedical applications of chitin and chitosan derivativesmedical applications of chitin and chitosan going forwardindustrial applications of chitin and chitosan derivativesproperties of chitin and chitosanapplications of chitin and chitosancharacterization of chitin and chitosanfunctional of chitin and chitosanmetabolic pathway of chitin and its oligosaccharides in marine bacterium vibriosand edible films to improve the quality of raisin cereal systemsrecommendations to improve the quality of teaching and learning to read english for computer science at vinh technical teachers training universityoil and gas industry in vietnammoreover because omron is constantly striving to improve its high quality products the information contained in this manual is subject to change without notice every precaution has been taken in the preparation of this manual nevertheless omron assunovel tools to improve fruit quality and pharmaceutical productionusing testing to improve the quality of your asp net mvc applicationhydrodynamic pressure processing to improve meat quality and safetyBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ