English idioms containing the word Heart and its synonyms in Vietnamese idioms a contrastive analysis from cultural perspectives

... VIETNAMESE IDIOMS: A CONTRASTIVE ANALYSIS FROM CULTURAL PERSPECTIVES (NHỮNG THÀNH NGỮ TIẾNG ANH CÓ CH A TỪ HEART VÀ TỪ ĐỒNG NGH A VỚI HEART TRONG THÀNH NGỮ TIẾNG VIỆT: ĐỐI CHIẾU NHÌN TỪ GÓC ... containing the word heart and its synonyms in Vietnamese In each language, idioms containing words of human body part possess a remarkable figure Accord...

Ngày tải lên: 02/03/2015, 14:29

... contrasting Methods of the study The main method applied in this thesis is contrastive analysis of idioms containing the word “heart” in English and its synonyms in Vietnamese from cultural perspectives ... characteristics 1.1.3 Idiomatic expressions containing the word “heart” in English and its synonyms in Vietnamese 1.1.3.1...

Ngày tải lên: 10/08/2015, 19:51

... Idiomatic expressions containing the word heart in English and its synonyms in Vietnamese 13 1.1.3.1 Literal and figurative meanings of heart and its synonyms in Vietnamese 13 1.1.3.2 Idiomatic ... Implications for learning and translating idioms in general 35 Suggestions for further studies 37 REFERENCES 38 APPENDICES Appendix 1: English idioms cont...

Ngày tải lên: 10/08/2015, 19:51

... What are the implications on teaching, learning and – finite Clauses and Its Application in Vietnamese English translating non – finite clauses? Translation 1.5 ORGANIZATION OF THE STUDY 1.2 AIMS ... translated in Therefore, the results of the study of the ways of Vietnamese the form of a verb, a noun, an adverb and a finite clau...

Ngày tải lên: 26/11/2013, 13:19

... can find the equivalents in using the verb "to have" both in English and in Vietnamese because the basic meaning of the verb to have in the two languages are quite the same However , the meaning ... ordinary verb and its equivalents in Vietnamese - Helping them know and apply the verb to have in some constructions and its eq...

Ngày tải lên: 18/12/2013, 21:45

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of...

Ngày tải lên: 20/02/2014, 11:20

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

... Some slang words and expressions can spread outside their original arena, and some may even lose their slang status and become accepted as a standard language; for example, in English : Adam and ... dialect and common in London at the time, containing aspects of Cockney rhyming slang, Romany,Back slang, Italian,theatre language ,criminal language….etc But today, it s...

Ngày tải lên: 18/03/2014, 00:21

... of N data points to be clustered The local maximum of a data point i is the data point whose magnitude is the maximum among all the data points within a certain distance from the data point i ... the clustering results of different methods The letters L, H, K, and S stand for the LMC method, the hierarchic clustering method, the K-mean clustering...

Ngày tải lên: 23/06/2014, 01:20

... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern...

Ngày tải lên: 10/08/2014, 22:21

... THE WIND" AND ITS TRANSLATION IN VIETNAMESE BY DUONG TUONG NGHIÊN CỨU TƯƠNG ĐƯƠNG BIỂU CẢM GI A TÁC PHẨM "CUỐN THEO CHIỀU GIÓ" VÀ BẢN DỊCH TIẾNG VIỆT C A DƯƠNG TƯỜNG MA Combined Programme Thesis ... more than 20 years ago Among several versions of the translation, the one translated by Duong Tuong is most praised by readers With the aim of investigating...

Ngày tải lên: 02/03/2015, 14:20

... of connotative equivalence achieved between the novel "Gone with the wind" and its translation by Duong Tuong? What strategies adopted by the translator to achieve such types of connotative equivalence? ... The novel was first translated into Vietnamese more than 20 years ago Among several versions of the translation, the one translated by Duong T...

Ngày tải lên: 10/08/2015, 19:47

... accounting innovations in Vietnamese companies as well as the awareness of companies managers or accountants about the relationship between corporate culture and the use of management accounting innovations ... culture? And what is the innovation of management accounting? Secondly, what is the relationship between the corporate cultu...

Ngày tải lên: 13/03/2014, 14:20

... VIETNAMESE NEWSLETTERS: A CONTRASTIVE ANALYSIS (PHÂN TÍCH ĐỐI CHIẾU LIÊN TỪ TRONG MỘT SỐ BỨC THƯ NGỎ TIẾNG ANH VÀ TIẾNG VIỆT) M .A MINOR PROGRAM THESIS FIELD: ENGLISH LINGUISTICS CODE: 60.22.15 ... implications for language teaching, learning and translation are given at the end of this part with a view to providing a new insight into a very important device of linking...

Ngày tải lên: 02/03/2015, 14:30

... Vietnamese Marketing Newsletters” The author analyzes and contrasts how to use conjunctions in English and Vietnamese marketing newsletters based on the syntactic and semantic features to find ... study Some possible implications for language teaching, learning and translation are given at the end of this part with a view to providing a new insight into a very import...

Ngày tải lên: 10/08/2015, 19:51