English idioms containing the word Heart and its synonyms in Vietnamese idioms a contrastive analysis from cultural perspectives
NHỮNG THÀNH NGỮ TIẾNG ANH CÓ CHỨA TỪ “HEART” VÀ TỪ ĐỒNG NGHĨA VỚI “HEART” TRONG THÀNH NGỮ TIẾNG VIỆT: ĐỐI CHIẾU NHÌN TỪ GÓC ĐỘ VĂN HÓA = english idioms containing the word heart and its synonyms in vietnamese idioms a contrastive analysis from cultural
... VIETNAMESE IDIOMS: A CONTRASTIVE ANALYSIS FROM CULTURAL PERSPECTIVES (NHỮNG THÀNH NGỮ TIẾNG ANH CÓ CH A TỪ HEART VÀ TỪ ĐỒNG NGH A VỚI HEART TRONG THÀNH NGỮ TIẾNG VIỆT: ĐỐI CHIẾU NHÌN TỪ GÓC ... containing the word heart and its synonyms in Vietnamese In each language, idioms containing words of human body part possess a remarkable figure According to statistics in Longman Dictionary ... based idioms in English are ones containing the word heart “Have a big heart, break your heart, follow heart are examples of heart- based idioms in English In Vietnamese, there are more than...
- 51
- 1,069
- 3
English idioms containing the word “heart” and its synonyms in Vietnamese A contrastive analysis from cultural perspectives
... contrasting Methods of the study The main method applied in this thesis is contrastive analysis of idioms containing the word “heart” in English and its synonyms in Vietnamese from cultural perspectives ... characteristics 1.1.3 Idiomatic expressions containing the word “heart” in English and its synonyms in Vietnamese 1.1.3.1 Literal and figurative meanings of “heart” and its synonyms in Vietnamese ... expressions containing the word “heart” and its synonyms in Vietnamese “Have a big heart, break your heart, follow heart” are examples of heart- based idioms in English In Vietnamese, there are more than...
- 10
- 731
- 3
English idioms containing the word Heart and its synonyms in Vietnamese idioms a contrastive analysis from cultural perspectives
... Idiomatic expressions containing the word heart in English and its synonyms in Vietnamese 13 1.1.3.1 Literal and figurative meanings of heart and its synonyms in Vietnamese 13 1.1.3.2 Idiomatic ... Implications for learning and translating idioms in general 35 Suggestions for further studies 37 REFERENCES 38 APPENDICES Appendix 1: English idioms containing heart I Appendix 2: Vietnamese idioms ... expressions containing the word heart and 14 its synonyms in Vietnamese 1.1.4 Some characteristics of Vietnamese and English culture 15 1.1.4.1 Hofstede’s value dimensions 15 1.1.4.2 Characteristics...
- 6
- 547
- 4
A study of the vietnamese translation of english non finite clauses and its application in vietnamese and english translation
... What are the implications on teaching, learning and – finite Clauses and Its Application in Vietnamese English translating non – finite clauses? Translation 1.5 ORGANIZATION OF THE STUDY 1.2 AIMS ... translated in Therefore, the results of the study of the ways of Vietnamese the form of a verb, a noun, an adverb and a finite clause They have translation of English non – finite clauses and its ... equivalents of non – finite Vietnamese Translation of English Non – finite Clauses and Its clauses is very abundant For example, in the translating process, Application in Vietnamese English Translation ,...
- 13
- 1,030
- 3
The verb to have in english and its equivalents in vietnamese
... can find the equivalents in using the verb "to have" both in English and in Vietnamese because the basic meaning of the verb to have in the two languages are quite the same However , the meaning ... ordinary verb and its equivalents in Vietnamese - Helping them know and apply the verb to have in some constructions and its equivalents in Vietnamese - By means of teaching suggestions of the verb ... encourages us to choose the topic: The verb "to have" in English and its equivalents in Vietnamese - Aims of the study - Helping Vietnamese learners understand the usages of the verb to have when...
- 49
- 752
- 4
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of the L3 cuticle Results Identification of cDNA ... involved in the molting process, we examined the effects of two PPase specific inhibitors, imidodiphosphate (IDP, 1-0631; Sigma) and NaF on development and molting of A suum lungstage L3 to fourth-stage...
- 13
- 691
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...
- 12
- 561
- 0
A study on rhyming slang in English and its equivalents in Vietnamese.
... Some slang words and expressions can spread outside their original arena, and some may even lose their slang status and become accepted as a standard language; for example, in English : Adam and ... dialect and common in London at the time, containing aspects of Cockney rhyming slang, Romany,Back slang, Italian,theatre language ,criminal language….etc But today, it seems to be died out Example: ... words and expressions can spread outside their original arena, and some may even lose their slang status and become accepted as a standard language Often, the widespread adoption of a slang term...
- 51
- 906
- 5
Báo cáo hóa học: " The Local Maximum Clustering Method and Its Application in Microarray Gene Expression Data Analysis" docx
... of N data points to be clustered The local maximum of a data point i is the data point whose magnitude is the maximum among all the data points within a certain distance from the data point i ... the clustering results of different methods The letters L, H, K, and S stand for the LMC method, the hierarchic clustering method, the K-mean clustering method, and the self-organization map clustering ... matches to the clusters in the models than the LMC and the hierarchic clustering methods 3.2 An application to microarray gene expression data Application of the LMC method to gene expression data...
- 11
- 409
- 0
báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc
... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern of the BCL11B gene and four of its related genes (TNFSF10, ... electrophoresis analysis The size of the PCR products of the b2M gene used for the BCL11B reference is 332 bp (line 1, 2) and that used for the four genes of interest is 145 bp (line 4-11) Line 3: DNA ladder...
- 7
- 410
- 0
a study on connotative equivalence between gone with the wind and its translation in vietnamese by duong tuong = nghiên cứu tương đương biểu cảm giữa tác phẩm cuốn theo chiều gió
... THE WIND" AND ITS TRANSLATION IN VIETNAMESE BY DUONG TUONG NGHIÊN CỨU TƯƠNG ĐƯƠNG BIỂU CẢM GI A TÁC PHẨM "CUỐN THEO CHIỀU GIÓ" VÀ BẢN DỊCH TIẾNG VIỆT C A DƯƠNG TƯỜNG MA Combined Programme Thesis ... more than 20 years ago Among several versions of the translation, the one translated by Duong Tuong is most praised by readers With the aim of investigating one of Duong Tuong' s best translated ... translation at the same time, in a translation, the image of the original‟s author is parallel to the one of the translator Landers as a translation theorist and translator himself states the requirement...
- 77
- 1,158
- 3
A study on connotative equivalence between Gone with the wind and its translation in Vietnamese by Duong Tuong
... of connotative equivalence achieved between the novel "Gone with the wind" and its translation by Duong Tuong? What strategies adopted by the translator to achieve such types of connotative equivalence? ... The novel was first translated into Vietnamese more than 20 years ago Among several versions of the translation, the one translated by Duong Tuong is most praised by readers With the aim of investigating ... All the above made the researcher decide to carry out the study on equivalence in literary translation Specifically, the study investigates connotation equivalence achieved in the translation...
- 3
- 584
- 3
the relationship between corporate culture and the use of management accounting innovations in vietnamese companies a study of techcombank
... accounting innovations in Vietnamese companies as well as the awareness of companies managers or accountants about the relationship between corporate culture and the use of management accounting innovations ... culture? And what is the innovation of management accounting? Secondly, what is the relationship between the corporate culture and the use of management accounting innovations in Techcombank? Finally, ... Techcombank The term of background information about management accounting innovations in Techcombank: 65% of twenty surveyed managers and accountants are aware of management accounting innovations...
- 86
- 898
- 0
conjunctions in some english and vietnamese newletters a contrastive analysis = phân tích đối chiếu liên từ trong một số bức thư ngỏ tiếng anh và tiếng việt
... VIETNAMESE NEWSLETTERS: A CONTRASTIVE ANALYSIS (PHÂN TÍCH ĐỐI CHIẾU LIÊN TỪ TRONG MỘT SỐ BỨC THƯ NGỎ TIẾNG ANH VÀ TIẾNG VIỆT) M .A MINOR PROGRAM THESIS FIELD: ENGLISH LINGUISTICS CODE: 60.22.15 ... implications for language teaching, learning and translation are given at the end of this part with a view to providing a new insight into a very important device of linking in English and Vietnamese ... word-class conjunction is a traditional one which can be divided into coordinating and subordinating conjunctions Coordinating conjunctions join grammatically equal elements whereas subordinating conjunctions...
- 55
- 1,182
- 5
Conjunctions in some English and Vietnamese newletters a contrastive analysis
... Vietnamese Marketing Newsletters” The author analyzes and contrasts how to use conjunctions in English and Vietnamese marketing newsletters based on the syntactic and semantic features to find ... study Some possible implications for language teaching, learning and translation are given at the end of this part with a view to providing a new insight into a very important device of linking in ... writer also introduces some famous studies related to conjunctions as a source to develop this thesis In Chapter 2, the researcher focuses on Contrastive analysis of conjunctions in English and Vietnamese...
- 4
- 477
- 5
Từ khóa: heart in english and its synonyms in vietnamesethe o fid and its applications in petroleum product analysisthe institutional army and its place in the u s armyidiomatic expressions containing the word eye in english and vietnamesecomparative analysis between idiomatic expressions containing the word eye in english and vietnamese equivalentsnew textbook english 10 the standard textbook and its language focus sectionnew textbook english 10 the standard textbook and its listening sectionwater distribution and its balance in the bodythe circuitry of the human spinal cord its role in motor control and movement disordersdisorders of the pituitary gland and its hypothalamic controldiseases of the nervous system and its symptomsexplain the structure of unix operating system and its components in briefunspecified disorder of the pituitary gland and its hypothalamic controlimportance of tourism industry and its role in the philippine economystructural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idiomsNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ