computational and experimental analyses of transcriptional r

Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx

... TWO PARTS Huntington and Scott Gallery Programs Grades 4–8  Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art PART I. HUNTINGTON’S ... Lesson Vocabulary aesthetic The science of the “beautiful” in a work of art. The aesthetic appeal of a work of art is defined by...

Ngày tải lên : 19/02/2014, 10:20

6
681
0

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

... oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough ... study the effect of LPS on the oxidation rate, a comparison of the effects of the LPSs of smooth E. coli a...

Ngày tải lên : 08/03/2014, 10:20

6
748
0

Báo cáo khoa học: Identiﬁcation of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf

... Identiﬁcation of calreticulin as a ligand of GABARAP by phage display screening of a peptide library Jeannine Mohrlu ă der 1,2 , Thomas Stangler 1,2 , Yvonne Hoffmann 1,2 , Katja Wiesehan 2 , ... human GABA A receptor-associated protein (GABARAP) is a protein implicated in the trafﬁcking of GABA A receptors to the plasma membrane [2,3]. Keywords calre...

Ngày tải lên : 16/03/2014, 05:20

13
560
0

Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

... features of aging. A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation ... Brunk and A. Terman (Eur. J. Biochem. 269) Ó FEBS 2002 MINIREVIEW The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochon...

Ngày tải lên : 17/03/2014, 23:20

7
444
0

Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot

... polymer. Wallace used similar reasoning stating that the interactions with the surface could act as a crosslink in the polymer by restraining certain chains. 11 For thin films, those less than approximately ... heated and is therefore able to measure the expansion and transitions of thin films more accurately. 13 2.7 Polymer Brushes An advancement in thin film polymers has appe...

Ngày tải lên : 23/03/2014, 01:20

80
375
0

Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

... analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a- induced early antiviral signalling Tim Maiwald 1, *, Annette Schneider 2, *, Hauke Busch 3 , ... 1105–1111. 10 Tamada Y, Nakao K, Nagayama Y, Nakata K, Ichikawa T, Kawamata Y, Ishikawa H, Hamasaki K, Eguchi K & Ishii N (2002) p48 Overexpression enhan...

Ngày tải lên : 23/03/2014, 03:20

14
432
0

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 ... characterized cytoskeleton and neurite formation in Cath .a- differen- tiated (CAD) cells, adding new information regarding this particular subject....

Ngày tải lên : 23/03/2014, 05:22

14
416
0

A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

... A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly Madeleine E. Hackney 1,5 Svetlana Kantorovich 2 and Gammon M. ... this study. This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson...

Ngày tải lên : 28/03/2014, 20:20

19
648
0

A Portrait of the Artist as a Young Man ppt

... M face, saw that it was a little red from the wax he was in. Was that a sin for Father Arnall to be in a wax or was he allowed to get into a wax when the boys were idle because that made them ... running back along the rods, of water being splashed in the basins. ere was a noise of rising and dressing and washing in the dormitory: a noise of clapping of...

Ngày tải lên : 31/03/2014, 14:20

317
341
0

Báo cáo hóa học: " Research Article Modelling Transcriptional Regulation with a Mixture of Factor Analyzers and Variational Bayesian Expectation Maximization" doc

... Conclusion We have investigated the application of Bayesian mixtures of factor analyzers (MFA-VBEM) to modelling transcriptional regulation in cells. Like recent approaches based on Bayesian factor analysis ... discussed, for instance, in McLachlan et al. [28]. We used a slight variation of the mixture of factor analyzers (MFAs) approach proposed in Ghahramani...

Ngày tải lên : 22/06/2014, 00:20

26
373
0

Báo cáo y học: "Changes in regional distribution of lung sounds as a function of positive end-expiratory pressure" potx

... diaphragmatic lung areas was observed during PEEP increase. This shift was not correlated with significant change in VT but was associated with an increase in Cdyn. High repeatability was obtained ... energy distribution increased in the diaphragmatic lung areas in 76% of the patients (26 of 34). In these cases, a larger peak-inspiratory flow image was obtained at high...

Ngày tải lên : 13/08/2014, 16:20

10
531
0

Báo cáo y học: "Dynamic cumulative activity of transcription factors as a mechanism of quantitative gene regulation" docx

... R181 Research Dynamic cumulative activity of transcription factors as a mechanism of quantitative gene regulation Feng He * , Jan Buer , An-Ping Zeng Đả and Rudi Balling * Addresses: * Biological Systems ... certain specific phases of the cell cycle of yeast [36] and/or annotated as being related to cell-cycle processes in the Gene Ontology database [38] (Addi...

Ngày tải lên : 14/08/2014, 08:20

18
273
0

Báo cáo y học: "Gene expression response in target organ and whole blood varies as a function of target organ injury phenotype" ppsx

... aminotransferase, alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, and sorbitol dehydrogenase. Additional data file 1 details the clinical chemistry value for each of these ... regarding the utility and applicability of the microarray technology in biological research and in particular with respect to understanding and classifying injury processes t...

Ngày tải lên : 14/08/2014, 20:22

13
284
0

computational and experimental analyses of transcriptional regulation as a function of dna sequence

Ngày tải lên : 14/11/2014, 06:05

183
185
0

top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern

... multiplicity in the final state and beyond the Standard Model top-antitop resonances search at the ATLAS detector at CERN. PhD thesis. http://theses.gla.ac.uk/5015/ Copyright and moral ... a function of the jet multipli c ity in the ﬁnal state and beyond the Standard Model top -a ntitop resonances search at...

Ngày tải lên : 22/12/2014, 22:04

251
712
0