... & Case Study A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation Francisco J. Forcadell 1 * and Fa ´ tima Guadamillas 2 1 Universidad Rey Juan Carlos, ... participation is the Knowledge and Process Management CASE STUDY A Knowledge Management Strategy Oriented to Innovation 169 series of es...
Ngày tải lên: 24/01/2014, 00:20
... using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwat...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Keep Your Shop in Tune A Best Management Practices Guide for Automotive Industries docx
... to water-based brake and carburetor cleaners instead of using chlorinated spray cans. Non-chlorinated solvents are also available. ã Keep an accurate inventory of all materials and wastes, in ... case of an audit by DEQ. Don’t forget to keep track of recyclable scrap materials like metal and scrap paper. Correctly manifest hazardous wastes. Ask for and maintain a Material Safety D...
Ngày tải lên: 19/02/2014, 04:20
Báo cáo khoa học: Enzymes of mannitol metabolism in the human pathogenic fungusAspergillus fumigatus– kinetic properties of mannitol-1-phosphate 5-dehydrogenase and mannitol 2-dehydrogenase, and their physiological implications pot
... mm), and so the choice of the constant level of Fru was not critical for determination of D K m (1.23 ± 0.15). The KIE data in Table 4 are instrumen- tal in delineating the kinetic mechanism of ... order of magnitude below the s H of AfM1PDH. Discussion Kinetic mechanism of Af M1PDH and Af M2DH The theory developed by Cook and Cleland is used to deduce...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... 5Â-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 Â (forward, the mutagenesis codon underlined) and 5Â-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3Â (reverse). The pET151 HP1287 plasmid was ... from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity Nicola Barison 1,2 , Laura Cendron 1,2 , Alberto Trento...
Ngày tải lên: 16/03/2014, 00:20
Anatomy of a Health Scare: Education, Income and the MMR Controversy in the UK doc
... behavior of parents at that point in time. Analysis of this data allows us to confirm that there was, at the peak of the controversy, a negative education gradient in the uptake of the MMR after controlling ... for the MMR between May 2004 and April 2005. Finally, there is up to a year’s gap between the parental decision on the other vaccines and the M...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
... Access Research Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland John F Menton*, Karen Kearney and John G Morgan Address: ... hospitals. Results: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt
... found that all positives belonged to the GII/4 variant of NoV. Conclusion: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method ... Central Page 1 of 8 (page number not for citation purposes) Virology Journal Open Access Research Development of a real-time RT-PCR and Reverse Li...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx
... 6:18 http://www.josr-online.com/content/6/1/18 Page 4 of 7 RESEARCH ARTICLE Open Access Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national ... 337 :a2 426. doi:10.1186/174 9-7 99X- 6-1 8 Cite this article as: Panesar et al.: Can...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf
... 6:18 http://www.josr-online.com/content/6/1/18 Page 4 of 7 RESEARCH ARTICLE Open Access Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national ... 102(7):25 6-8 . 13. National Patient Safety Agency: National Reporting and Learnin...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo y học: "The establishment of a primary spine care practitioner and its benefits to health care reform in the United States" docx
... spine . Primary Care for the Spine Primary care is defined by the American Academy of Family Physicians (AAFP) as “that care provided by physi- cians specifically trained for and skilled in comprehensive first ... bring value to spine care, regulatory and legislative bodies that may have to institute changes in allowing this area of health care to fully...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo y học: " Treatment of candidemia and invasive candidiasis in the intensive care unit: post hoc analysis of a randomized, controlled trial comparing micafungin and liposomal amphotericin " pot
... 5 Research Treatment of candidemia and invasive candidiasis in the intensive care unit: post hoc analysis of a randomized, controlled trial comparing micafungin and liposomal amphotericin B Bertrand ... following outcomes in patients treated for candidemia and invasive candidiasis: over- all treatment success; mycological response; a...
Ngày tải lên: 13/08/2014, 19:20
settlement of a strikes by collective bargaining and mediation under vietnamese law- in comparision with the swedish system
... take part at the stage of collective bargaining. With a mechanism in which there is participation by the two parties only, collective bargaining depends on the capacity of each party. Their attitude ... nations, including Sweden, collective bargaining may be mandatory. Generally, the settlement of a strike by collective bargaining has been recognized...
Ngày tải lên: 18/08/2014, 12:36
Appropriate methods in determining the event mean conce pollutant removal efficiency of a best management practice ntration and
... pre-treatment of the storm- Fig. 1. Schematic of the swirl and filtration system. Appropriate Methods in Determining the Event Mean Concentration and Pollutant Removal Efficiency of a Best Management ... Multiple hydro -and polluto graphs for the 07/09/2007 storm event. Appropriate Methods in Determining the Event Mean Concentration and...
Ngày tải lên: 11/10/2014, 02:19
studies of pathogenesis-related proteins in the strawberry plant partial purification of a chitinase-containing protein complex and analysis of an osmotin-like protein gene
... STUDIES OF PATHOGENESIS-RELATED PROTEINS IN THE STRAWBERRY PLANT: PARTIAL PURIFICATION OF A CHITINASE-CONTAINING PROTEIN COMPLEX AND ANALYSIS OF AN OSMOTIN-LIKE PROTEIN GENE ... 2 PARTIAL PURIFICATION OF A CHITINASE-CONTAINING PROTEIN COMPLEX IN THE STRAWBERRY PLANT …………………………32 3 ISOLATION OF AN OSMOTIN-LIKE...
Ngày tải lên: 13/11/2014, 09:25