... et al. Rainbow trout interleukin-11 FEBS Journal 272 (2005) 11361147 ê 2005 FEBS 1137 Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss Tiehui ... (NQT) are in bold and underlined. The four potential poly(A) signals (AATAAA) in the 3Â-UTR and the TATA box in the 5Â-anking region are b...
Ngày tải lên: 07/03/2014, 16:20
... 38-kDa bovine protein is a ể FEBS 2002 Bovine sterol D14-reductase cloning (Eur. J. Biochem. 269) 285 Cloning and expression of sterol D14-reductase from bovine liver Rita Roberti 1 , Anna Maria ... verify our hypothesis, bovine cDNA encoding the 38-kDa protein was cloned to iden tify the catalytic activity of the expressed protein. Cloning of the cDNA enc...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
... Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase Christiane Stuhlfelder, Martin J. Mueller and Heribert Warzecha Lehrstuhl fu ă r Pharmazeutische ... application of JA. These experiments demonstrate that individual mem- bers of the jasmonate family are involved – at least in Arabidopsis – in different signalling pathways....
Ngày tải lên: 16/03/2014, 18:20
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx
... used as a control of sample loading. 2848 I. Gavidia et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves Isabel Gavidia 1,2 , ... two full-length cDNAs from D. purpurea leaves that encode DpAR1 and DpAR2, two new members of the AKR superfamily; specifically, the amino-acid seq...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo khoa học: Cloning and functional characterization of Arabidopsis thaliana D-amino acid aminotransferase – D-aspartate behavior during germination pdf
... the metabolism of d-Asp in the plant by catalyzing trans- amination between d-amino acids. This is the first report of cDNA cloning and functional characterization of a d-amino acid aminotransferase ... we report on the biochemical behavior of d-amino acids (particularly d-Asp) and relevant metabolic enzymes in Arabidopsis thaliana. During germination and...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx
... for gene therapy in cancer. Results Cloning of the 5Â-upstream region of the Pokemon gene To identify the regulatory sequences that control expression of the Pokemon gene, a 2204-bp section of the ... To further determine the cooperation between the NEG-U and NEG-D elements, 2 lg of the NEG-U decoy, 2 lg of the NEG-D decoy, and a combination of...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx
... gene regu- lation, by modulating the level of expression and ⁄ or determining the specific pattern of expression of a gene [34–39]. To evaluate the relevance of the leader intron in cardosin expression, ... library screening of four full-length genes encoding cardosins A, B, C and D precursors, together with the cloning of a partial sequence of the cypros...
Ngày tải lên: 30/03/2014, 09:20
Báo cáo khóa học: Cloning and expression of murine enzymes involved in the salvage pathway of GDP-L-fucose ppt
... of mouse fucokinase at the 3Â end. ể FEBS 2003 The salvage pathway of GDP- L -fucose in mouse (Eur. J. Biochem. 271)79 Cloning and expression of murine enzymes involved in the salvage pathway of GDP- L -fucose L -fucokinase ... from porcine kidney and the corresponding gene has been cloned from human [23]. In the present study we have cloned the...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc
... silica-less diatom in which eicosapentaenoic acid accumulates up to 30% of the total fatty acids. This marine diatom was used for cloning genes encoding fatty acid desaturases involved in eicosapentaenoic acid ... as D5- and D6-fatty acid desaturases. The substrate specificity of each enzyme was determined and confirmed their involvement in eicosapentaenoic a...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo sinh học: "Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication" pot
... Orlandi et al.: Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication. Journal of Translational Medicine ... 9:106 http://www.translational-medicine.com/content/9/1/106 Page 9 of 9 RESEARC H Open Access Molecular and cellular correlates of the CIITA-med...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo toán học: "Differential display identifies overexpression of the USP36 gene, encoding a deubiquitinating enzyme, in ovarian cancer" pot
... ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcg aggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacat agaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaa aattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgct aacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’ ). The synthesized riboprobe was precipitated by ... measured by liquid scintillation analysis. The probe for USP...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot
... persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature Ennio Polilli 1 , Giustino Parruti 2 *, ... strain as the dominant quasispecies after very short exposure to efavirenz in vivo. Case presentation: A 55-year-o...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo sinh học: " Genetic and morphological characterisation of the Ankole Longhorn cattle in the African Great Lakes region" pptx
... 0.01, and ***P < 0.001. Genetic and morphological characterisation of the Ankole cattle 471 Original article Genetic and morphological characterisation of the Ankole Longhorn cattle in the African ... disease and other stresses in improvement of ruminant livestock in the tropics, in: Proceedings of the 5th Genetic and morpholog...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " Cloning and expression profiling of the VLDLR gene associated with egg performance in duck (Anas platyrhynchos)" docx
... Access Cloning and expression profiling of the VLDLR gene associated with egg performance in duck (Anas platyrhynchos) Cui Wang, Shi-jun Li, Wen-hua Yu, Qing-wu Xin, Chuang Li, Yan-ping Feng, ... ligand binding motifs (S-D-E) and eight cysteine-rich repeats within the ligand binding domain; (ii) five YWXD motifs in the EGF pre- cursor homology domain; (...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo y học: "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust" docx
... group, the study of small RNAs in the hemimetabolous group, including several ancient orders of insects, could aid in understanding the whole picture of evolution and function of small RNAs in insects. The ... understanding of the impact of these elements on genome evolution of the locust and related species. Classification of the rest of the s...
Ngày tải lên: 14/08/2014, 21:20