a large scale, multicentre, double-blind trial of ursodeoxycholic acid in pts with chronic hepatitis c 2007
báo cáo hóa học:" Improvement in quality of life measures in patients with refractory hepatitis C, responding to re-treatment with Pegylated interferon alpha -2b and ribavirin" docx
... re-treated with a combination of interferon alpha 2b and ribavirin. The responders sustained a significant decrease in the domain score of vitality while 5 of the 8 domain scores decrease in non-responders ... design, a mixed-effects linear model, having an unstructured variance-covariance matrix was fit to each quality of life outcome to assess changes across time (weeks)...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo y học: "Serological and molecular expression of Hepatitis B infection in patients with chronic Hepatitis C from Tunisia, North Africa" pdf
... HCV: Hepatitis C Virus; DNA: Desoxyribonucleic Acid; RNA: Ribonucleic Acid; HCC: Hepatocellular Carcinoma; HBsAg: Hepatitis B surface Antigen; anti- HCV: Hepatitis C Virus antibodies; HBcAb: Hepatitis ... RESEARC H Open Access Serological and molecular expression of Hepatitis B infection in patients with chronic Hepatitis C from Tunisia, North Africa Samar Ben Hal...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx
... 5’-CTGCCTGGCAGAAAACTTACC-3’ ; reverse primer, 5’-CTCTGTTATTCTCTGGTGAGTCT CCTT-3’; probe, 5’CATCACACATATCTGTAAATCTC TGCCCCTGTTAGA-3’ ). Co-amplification of the beta- glucuronidase gene (Assay-On-Demand, ... tran- scriptional induction of all miR NAs investigated as well as MxA-mRNA (Figure 1). In particular, of t he miRNAs Table 1 Demographic and clinical characteristics of patients...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"
... 2008.11.12 Cardiovascular disease (CVD) is a major cause of morbidity and mortality in patients with chronic kidney disease (CKD) patients. Serum albumin, a negative acute-phase reactant and marker ... have classified the presence of CKD as a cardio- vascular risk factor (9, 13, 14). These findings led to the evaluation of novel cardiovascular risk factors like chronic...
Ngày tải lên: 03/11/2012, 11:52
Báo cáo y học: " Phase IIb randomized trial of adjunct immunotherapy in patients with first-diagnosed tuberculosis, relapsed and multi-drug-resistant (MDR) TB" doc
... [36]. List of abbreviations 1 st Dx: first-diagnosed; A: amikacin; AFB: acid- fast bacilli; ALT: alanine transaminase; ATT: anti-tuberculosis therapy; BCG: Bacille Calmette-Guérin; C: capreomycin; Ci: cilastatin; ... in this arm are abbreviated as follows: Isoniazid (H), Rifampicin (R), Pyrazinamide (Z), Ethambutol (E), Streptomycin (S), Ofloxacin (O), Amikacin (A) , Capreomycin (C) ,...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"
... 1 was 5′-TGTCTCGTGTTACAGGCGGGGT-3', asymmetric primer 2 was 5′-GAGGCATAGCAGCAGGA GAAGAG-3', and fluorescent primer was 5′-TCGCTGGAAGTGTCTGCGGCGT-3'. Serum assays Fasting ... influence CHB still re- mains unclear (4), particularly in HBeAg-negative CHB patients. In contrast, a large body of evidence showed the incidence of hepatic steatosis in chronic...
Ngày tải lên: 25/10/2012, 11:48
Báo cáo y học: "Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients with chronic hepatitis C infection-associated polyarticular involvement" potx
... polyarticular involvement Michele Bombardieri*, Cristiano Alessandri*, Giancarlo Labbadia, Cristina Iannuccelli, Francesco Carlucci, Valeria Riccieri, Vincenzo Paoletti and Guido Valesini Cattedra di ... http://arthritis-research.com/content/6/2/R137 Research article Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx
... CAS E REP O R T Open Access Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report Savvas Ioannou, Gregorios Hatzis, Ioanna ... cases of chronic hepatitis, 40% of cases of end-stage cirrhosis, 60% of cases of hepatocell ular carcinoma, and 30% of liver transplants [1]. Moreover, extrahepati c...
Ngày tải lên: 11/08/2014, 03:21
Báo cáo y học: "Pancytopenia and atrial fibrillation associated with chronic hepatitis C infection and presumed hepatocellular carcinoma: a case report" pot
... citation purposes) Journal of Medical Case Reports Open Access Case report Pancytopenia and atrial fibrillation associated with chronic hepatitis C infection and presumed hepatocellular carcinoma: ... kaberi.dasgupta@mcgill.ca * Corresponding author Abstract Introduction: Pancytopenia secondary to hepatitis viral infection is a rare but noted clinical entity. An acute aplastic...
Ngày tải lên: 11/08/2014, 21:22
Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt
... include search engines, information extraction from unstructured sources, and data mining of large text collections and scientific data. Lawrence Page was born in East Lansing, Michigan, and ... interests include the link structure of the web, human computer interaction, search engines, scalability of information access interfaces, and personal data mining. 8 Appendix A: Advert...
Ngày tải lên: 24/01/2014, 20:20