Báo cáo khoa học: " Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" pptx

Báo cáo khoa học: " Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" pptx

Báo cáo khoa học: " Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" pptx

... Protection Office of Washington University. Raw sewage One 10 L-sample of raw sewage was collected in an urban wastewater treatment plant in the area of Barcelona, Spain. The sample was collected in a ... child in Australia with acute diarrhea. Sequencing and phylogenetic analysis demonstrated that this virus is a novel member of the family Picornaviridae. We propose t...

Ngày tải lên: 12/08/2014, 04:22

7 583 0
Báo cáo y học: "Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" potx

Báo cáo y học: "Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" potx

... child in Australia with acute diarrhea. Sequencing and phylogenetic analysis demonstrated that this virus is a novel member of the family Picornaviridae. We propose that this virus be named klassevirus ... Howley DMKaPM. Philadelphia: Lippincott Williams & Wilkins; 2007:795-838. 13. Yamashita T, Kobayashi S, Sakae K, Nakata S, Chiba S, Ishihara Y, Iso- mura S: Isolation of...

Ngày tải lên: 12/08/2014, 04:21

7 328 0
Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx

Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx

... [1] and code for an extremely con- served 10 kDa protein. The Chlamydomonas, Caenor- habditis elegans, Drosophila and mammalian LC8 orthologs share more than 90% identity. The two mammalian paralogs ... Journal compilation ª 2011 FEBS 88 Haraguchi K, Satoh K, Yanai H, Hamada F, Kawabu- chi M & Akiyama T (2000) The hDLG-associated pro- tein DAP interacts with dynein light chain and n...

Ngày tải lên: 14/03/2014, 22:20

17 573 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

... splice acceptor 1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 4 ... 2009 The Authors Journal compilation ª 2009 FEBS SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation Alpana Ray 1 , Srijita Dhar 1 , Arvind...

Ngày tải lên: 07/03/2014, 02:20

11 439 0
Báo cáo khoa học: "Mac-1-mediated Uptake and Killing of Bordetella bronchiseptica by Porcine Alveolar Macrophages" pptx

Báo cáo khoa học: "Mac-1-mediated Uptake and Killing of Bordetella bronchiseptica by Porcine Alveolar Macrophages" pptx

... showing a linear range of response in bacterial invasion assays, the binding and uptake pattern of B. bronchiseptica at various ratios of bacteria to AM was determined. Linear responses of bacteria ... and uptake were demonstrated in less than 50:1 (bacteria/AMf) ratio (data not shown), and the ratio 25:1 (bacteria/AMf) was therefore selected in further bacterial binding and upt...

Ngày tải lên: 07/08/2014, 17:22

9 194 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

... further investigation. Specifically, what is the actual structure of the glycan moiety in the native tx 5a peptide? Our NMR data indicates an a- D -Gal-(1fi3) -a- D -GalNAc-Thrstructureforthisgly- can, and a renewed ... illustrating the NOEs observed between the amino acids side chains of residues Thr10 and Ala12 and the carbohy- drate moieties of GalNAc (GN) and Gal (...

Ngày tải lên: 23/03/2014, 13:20

11 563 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... in critically revising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis, interpretation and drafting the manuscript. Acknowledgements To ... and the pharmacist remained the same, so this did not influence the results. Pharmacist attendance at ward rounds has been associated with a reduction in adverse events [15]....

Ngày tải lên: 25/10/2012, 10:39

6 526 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

... CAGCAACGCAAGCTTG C GTCGACCTGCAGCCCAAGCTTGCGTTGCTG A- flap ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC B-flap CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA B-g1 CAGCAACGCAAGCTT B-g2 CAGCAACGCAAGCT B-g4 CAGCAACGCAAG A- b15 ... CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC X3 GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC X4 GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAGCGTC X1half GGACATCTTTGCCCACGTT...

Ngày tải lên: 07/03/2014, 10:20

14 433 0
Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

... clearly indicates that this is indeed the case, and that these interactions may be representative of a suite of inter- actions and structural changes that are required for catalysis across this ... [19] catalytic activity. Interestingly, maximal activity of domain 2 was achieved only when domain 1 was functional, reinforcing, once again, the idea that catalysis at one active sit...

Ngày tải lên: 16/03/2014, 06:20

9 568 0
w