Báo cáo khoa học: "Epstein-Barr Nuclear Antigen 1 modulates replication of oriP-plasmids by impeding replication and transcription fork migration through the family of repeat" ppt

Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

... FEBS 5277 Role for nectin -1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells Vaibhav Tiwari 1 , Myung-Jin Oh 1 , Maria Kovacs 1 , Shripaad Y. Shukla 1 , Tibor ... RNA (nectin -1) Si RNA (control) 562 375 Counts 18 7 0 10 0 FL 1 Log 10 1 10 2 10 3 10 4 Fig. 5. Role of nectin -1 during HSV -1 e...

Ngày tải lên: 18/02/2014, 14:20

14 672 0
Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult pptx

Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult pptx

... PEP-1–HSP27 against brain ischemia FEBS Journal 275 (2008) 12961308 ê 2008 The Authors Journal compilation ê 2008 FEBS 1307 Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ... PEP-1–HSP27 fusion protein plays a defensive role against cell death induced by oxidative stress in the cells. Transduced PEP-1–HSP27 protects against...

Ngày tải lên: 18/02/2014, 17:20

13 468 0
Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf

Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf

... 2007 The Authors Journal compilation ê 2007 FEBS 1357 MINIREVIEW The nuclear lamina Both a structural framework and a platform for genome organization Joanna M. Bridger 1 , Nicole Foeger 2 , Ian ... AM, Columbaro M, Scarano G, Mattioli E, Sabatelli P, et al. (2005) Alterations of nuclear envel- ope and chromatin organization in mandibuloacral dys- plasia, a...

Ngày tải lên: 19/02/2014, 02:20

8 511 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

... 2009 The Authors Journal compilation ê 2009 FEBS SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation Alpana Ray 1 , Srijita Dhar 1 , Arvind Shakya 1 , Papiya ... 3Â splice acceptor 1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364...

Ngày tải lên: 07/03/2014, 02:20

11 439 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

... devoid of a given essential amino acid. Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dep...

Ngày tải lên: 07/03/2014, 03:20

12 561 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... TTAGTTACCGTGTGCTTC OMCB- F CTGCTGCTCGCAGCAAGT OMCB- R GTGTGATCTGCAACTGTT OMCA- PBAD-F CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA- PBAD-R TTAGTTACCGTGTGCTTC OMCB- PBAD-F CACCGAGGAATAATAAATGATG AACGCACAAAAATCA OMCB- PBAD-R ... study. Oligonucleotide name Sequence (5Â -to3 Â) OMCA- KO-F CACACTGCAACCTCTGGT OMCA- KO-R ACTGTCAATAGTGAAGGT OMCB- KO-F CCCCATGTCGCCTTTAGT OMCB- KO-R TCGCTAGAA...

Ngày tải lên: 07/03/2014, 09:20

11 732 0
Báo cáo khoa học: Alpha-fetoprotein antagonizes X-linked inhibitor of apoptosis protein anticaspase activity and disrupts XIAP–caspase interaction ppt

Báo cáo khoa học: Alpha-fetoprotein antagonizes X-linked inhibitor of apoptosis protein anticaspase activity and disrupts XIAP–caspase interaction ppt

... AFP antagonizes XIAP function FEBS Journal 273 (2006) 38373849 ê 2006 The Authors Journal compilation ê 2006 FEBS 3845 Alpha-fetoprotein antagonizes X-linked inhibitor of apoptosis protein anticaspase ... Ac-Asp-Glu-Val-Asp-7-amino-4-methyl coumarin; AFP, a-fetoprotein; IAP, inhibitor of apoptosis protein; IBM, IAP-binding motif; RFU, relative fluorescence units; XIAP...

Ngày tải lên: 07/03/2014, 12:20

13 445 0
Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx

Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx

... Fitz- gerald MC & Hendrickson WA (2007) Structural and thermodynamic characterization of a cytoplasmic dynein light chain intermediate chain complex. Proc Natl Acad Sci USA 104, 10028–10033. 16 Hall ... and mediates DNA damage-induced p53 nuclear accumulation. J Biol Chem 280, 8172–8179. 11 Navarro C, Puthalakath H, Adams JM, Strasser A & Lehmann R (2004) Egalitarian...

Ngày tải lên: 14/03/2014, 22:20

17 573 0
Báo cáo khoa học: Yeast oxidative stress response Influences of cytosolic thioredoxin peroxidase I and of the mitochondrial functional state pot

Báo cáo khoa học: Yeast oxidative stress response Influences of cytosolic thioredoxin peroxidase I and of the mitochondrial functional state pot

... 2006 The Authors Journal compilation ê 2006 FEBS Yeast oxidative stress response Influences of cytosolic thioredoxin peroxidase I and of the mitochondrial functional state Ana P. D. Demasi 1 , ... glutathione peroxidase III, heat shock protein 104, thioredoxin peroxidase II, catalase A, nuc- lear thioredoxin peroxidase, thioredoxin I and glutar...

Ngày tải lên: 16/03/2014, 14:20

12 363 0
Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx

Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx

... compilation ª 2008 FEBS Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells Feng-Ming Yang, Chien-Ting Pan, Huei-Man Tsai, ... further indicate a novel regulatory mechanism of cAMP signaling for altering the sumoylation cycle, involving modulating the expression of sum...

Ngày tải lên: 23/03/2014, 06:20

12 443 0
Báo cáo khoa học: "Paradigmatic Cascades: a Linguistically Sound Model of Pronunciation by Analogy" docx

Báo cáo khoa học: "Paradigmatic Cascades: a Linguistically Sound Model of Pronunciation by Analogy" docx

... experimentally evaluate a new model of pronunciation by analogy: the paradigmatic cascades model. Given a pronunciation lexicon, this algorithm first extracts the most productive paradigmatic mappings ... domain of an alternation to a certain class of words, and ac- cordingly reduce the expansion of the analog set. 4.3 Perspectives The paradigmatic cascades mo...

Ngày tải lên: 31/03/2014, 21:20

8 311 0
Báo cáo y học: "LMP-420, a small-molecule inhibitor of TNF-alpha, reduces replication of HIV-1 and Mycobacterium tuberculosis in human cell" pps

Báo cáo y học: "LMP-420, a small-molecule inhibitor of TNF-alpha, reduces replication of HIV-1 and Mycobacterium tuberculosis in human cell" pps

... Central Page 1 of 9 (page number not for citation purposes) AIDS Research and Therapy Open Access Research LMP-420, a small-molecule inhibitor of TNF-alpha, reduces replication of HIV-1 and Mycobacterium ... Corresponding author Abstract Background: Co-infections of human immunodeficiency virus (HIV) and Mycobacterium tuberculosis (M. Tb) are steadily incr...

Ngày tải lên: 10/08/2014, 05:20

9 404 0
báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

... with a higher potential for parthenocarpy always produced more carpelloid structures. Parthenocarpic potential in C. annuum is not caused by a mutation in CaARF8 Similar to t omato and Arabidopsis, ... 11:143 http://www.biomedcentral.com/1471-2229/11/143 Page 13 of 14 RESEARCH ARTICLE Open Access Parthenocarpic potential in Capsicum annuum L. is enhanced...

Ngày tải lên: 11/08/2014, 11:21

15 374 0
Báo cáo khoa học: "Epstein-Barr Nuclear Antigen 1 modulates replication of oriP-plasmids by impeding replication and transcription fork migration through the family of repeat" ppt

Báo cáo khoa học: "Epstein-Barr Nuclear Antigen 1 modulates replication of oriP-plasmids by impeding replication and transcription fork migration through the family of repeat" ppt

... Access Research Epstein-Barr Nuclear Antigen 1 modulates replication of oriP-plasmids by impeding replication and transcription fork migration through the family of repeats Ashok Aiyar* 1, 2 , Siddhesh Aras 2 , ... could terminate the migration of transcription forks, and thereby protect rep- lication forks initiated at DS. EBNA1 bound to FR impe...

Ngày tải lên: 12/08/2014, 04:21

15 212 0
Báo cáo y học: " Interferon-γ inhibits interleukin-1β-induced matrix metalloproteinase production by synovial fibroblasts and protects articular cartilage in early arthritis" doc

Báo cáo y học: " Interferon-γ inhibits interleukin-1β-induced matrix metalloproteinase production by synovial fibroblasts and protects articular cartilage in early arthritis" doc

... Interferon-? inhibits interleukin-1?-induced matrix metalloproteinase production by synovial fibroblasts and protects articular cartilage in early arthritis Arthritis Research & Therapy ... expres- sion in joints affected by AIA on Day 1. Abundant stain- ing was detected in the synovial lining layer, joint exudate and focal areas of synovial infiltrat...

Ngày tải lên: 12/08/2014, 12:20

10 181 0
Từ khóa:
w