Novel biomarkers predict liver fibrosis in hepatitis C patients: alpha 2 macroglobulin, vitamin D binding protein and apolipoprotein AI pdf

Novel biomarkers predict liver fibrosis in hepatitis C patients: alpha 2 macroglobulin, vitamin D binding protein and apolipoprotein AI pdf

Novel biomarkers predict liver fibrosis in hepatitis C patients: alpha 2 macroglobulin, vitamin D binding protein and apolipoprotein AI pdf

... properly cited. Research Novel biomarkers predict liver fibrosis in hepatitis C patients: alpha 2 macroglobulin, vitamin D binding protein and apolipoprotein AI Ai-Sheng Ho †1 , Chun-Chia Cheng 2, 3 , ... Hepatol 20 00, 32: 911- 920 . doi: 10.1186/1 423 -0 127 -17-58 Cite this article as: Ho et al., Novel biomarkers predict liver fibrosis in...

Ngày tải lên: 10/08/2014, 05:21

7 253 0
Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot

Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot

... protease domains, creating a well-defined binding cleft (Fig. 1A) [7]. Indeed, it appears that certain residues in the heli- case domain may interact directly with substrates or product-based inhibitors binding ... the helicase and the protease domains is framed and shown in detail in (B). The cata- lytic triad, H57, D8 1 and S139, in the pro- tease domain, and the conserv...

Ngày tải lên: 16/03/2014, 06:20

8 308 0
Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

... from each low inducer replicon [Con-15 (15/1, 15 /2, 15/3), Con-17 (17/1, 17 /2, 17/3) and Con -24 (24 /1, 24 /2, 24 /3)] were prepared. The nine different replicon cell lines were maintained in the ... exposed to HCV slowly develop into chronic infec- tion. Long-standing chronic inflammation in the liver due to the virus infection leads to liver cirrhosis and carci- noma [1-7]....

Ngày tải lên: 18/06/2014, 18:20

13 305 0
Báo cáo hóa học: " Evidence of structural genomic region recombination in Hepatitis C virus" pdf

Báo cáo hóa học: " Evidence of structural genomic region recombination in Hepatitis C virus" pdf

... Uruguay and 2 Department of Biochemistry and McGill Cancer Center, McGill University, Montreal, Quebec, H3G 1Y6, Canada Email: Juan Cristina* - cristina@cin.edu.uy; Rodney Colina - rcolina@cin.edu.uy * ... Cristina* 1 and Rodney Colina 1 ,2 Address: 1 Laboratorio de Virología Molecular, Centro de Investigaciones Nucleares, Facultad de Ciencias, Universidad de la República, Iguá 42...

Ngày tải lên: 20/06/2014, 01:20

8 247 0
Báo cáo y học: " Non-invasive stroke volume measurement and passive leg raising predict volume responsiveness in medical ICU patients: an observational cohort study"

Báo cáo y học: " Non-invasive stroke volume measurement and passive leg raising predict volume responsiveness in medical ICU patients: an observational cohort study"

... ventilator as well as changes in car- diac index during PLR were examined. An increase in cardiac index of 10% or more during PLR predicted an increase in car- diac index following VE of 15% or more ... contributions WI conceived and designed the study, participated in drafting the manuscript, and provided supervision. MK participated in the study design, provided critical revis...

Ngày tải lên: 25/10/2012, 10:06

9 742 0
Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx

Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx

... SPRFC2-F1 (5¢-CCC CGGGGTTGGTAC-3¢) and SPRFC2-F2 (5¢-CAACCC CGGGGGATG-3¢) to produce a five amino acid extension (insertion K26a) or SPRFC2-F3 (5¢-CCCCGGTGGGGT TGGGCCCGGGGTTGGTAC-3¢) and SPRFC2-F4 ... insertions in N-terminal AAA + domain (domain I, shown in A), central domain (domain II, B) and C- terminal collar domain (domain III, C) of fission yeast Rfc2. The aligned sequences o...

Ngày tải lên: 07/03/2014, 02:20

11 503 0
Báo cáo y học: "Three novel beta-galactosidase gene mutations in Han Chinese patients with GM1 gangliosidosis are correlated with disease severity" ppsx

Báo cáo y học: "Three novel beta-galactosidase gene mutations in Han Chinese patients with GM1 gangliosidosis are correlated with disease severity" ppsx

... 3’) c. 30 4C& gt;G p.His102Asp 3 F: AACTGGTACTGTCCTGGCCAGGGCTCATGAAAGTTCCAG R: CCTGGCCAGGACAGTACCAGTTTTCTGAGGAC GATGATGTGGAATATTTTC c. 495_497delTCT p. L166del 5 F: ACCACTTGTCCACAGCTGCCAGGTAATCTGGGTCGGAGG R: ... ACCACTTGTCCACAGCTGCCAGGTAATCTGGGTCGGAGG R: CTGGCAGCTGTGGACAAGTGGTTGGGAGTCCT—GCCCAAGATGAAGCCTC c. 90 2C& gt;T p.Ala301Val 8 F: AAGTATATCATAGAGGGAGGAAGCCAC TGCTTCGGTCTTG R: TTCCTCCCT...

Ngày tải lên: 10/08/2014, 05:21

8 451 0
Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

... (upper strands only): rpL 32 ( )24 +11) fragment, 5¢-CTTGCGCGCCGCC GCCGCCTCTTCCTTCTTCCTCG-3¢; ZF5 binding site, 5¢-CAGGTACCGCGCCTTCGCTGCCA-3¢; (GCC) 3 ele- ment, 5¢ -AGCTTGCCGCCGCCTTCGA-3¢; (GCC) 9 ele- ment, ... 5¢-AGCTTGCCGCCGCCGCCGCCGCCGCCGCC GCCTTCGA-3¢; rpL 32 pyrimidine motif ()6 +11), 5¢-CTCTTCCTTCTTCCTCG-3¢; lactoferrin binding site, 5¢-CTAGTGCAAGTGCCA-3¢. The synthetic oligonuc...

Ngày tải lên: 07/03/2014, 05:20

15 472 0
Báo cáo khoa học: Cause of mortality in insects under severe stress Hitoshi Matsumoto, Kohjiro Tanaka, Hirofumi Noguchi and Yoichi Hayakawa pdf

Báo cáo khoa học: Cause of mortality in insects under severe stress Hitoshi Matsumoto, Kohjiro Tanaka, Hirofumi Noguchi and Yoichi Hayakawa pdf

... byHPLC–electrochemical detection (ECD) [9]. A dissected brain was placed in a 1.5-mL microtest tube containing 70 lL0 .2 M perchloric acid, sonicated, and centrifuged at 20 000 g for 10 min. A ... (A,B) and · 20 000 (C, D) . Note that the neurilemma of MPLI-injected larva is thinner (indicated with bars shown in A and B) and less dense (indicated with stars as shown in C...

Ngày tải lên: 23/03/2014, 21:20

8 234 0
w