prevention of hepatitis c infection in egypt

báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

... for contracting hepatitis C. Stratification was achieved in blocks of six within each variable, such that in each block of six half of the clients would receive SEC and half of the clients EPC. ... infection in injecting drug users. HCV transmission risk behaviours include injecting drugs, the sharing of injecting equipment, not cleaning and reusing drug paraphernalia, alcohol misuse, cocaine ... take place through changes in outcome expectancies (expected con- sequences of a course of action, e.g. sharing injecting equipment) and self efficacy (confidence in one's ability to achieve...

Ngày tải lên: 11/08/2014, 18:20

12 454 0
Báo cáo y học: "Serological and molecular expression of Hepatitis B infection in patients with chronic Hepatitis C from Tunisia, North Africa" pdf

Báo cáo y học: "Serological and molecular expression of Hepatitis B infection in patients with chronic Hepatitis C from Tunisia, North Africa" pdf

... Demographical characteristics and HCV genotype of HCV positive patients according to their HBV status HBV (-) Resolutive HBV infection Ongoing HBV infection Ongoing HBV infection Overt HBV infection Occult ... Sagnelli E, Coppola N, Marrocco C, Onofrio M, Sagnelli C, Coviello G, Scolastico C, Filippini P: Hepatitis C virus superinfection in hepatitis B virus chronic carriers: a reciprocal viral interaction ... E, Coppola N, Scolastico C, Filippini P, Santantonio T, Stroffolini T, Piccinino F: Virologic and clinical expressions of reciprocal inhibitory effect of hepatitis B, C, and delta viruses in...

Ngày tải lên: 12/08/2014, 01:21

6 516 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... 150 ʜʜ cgucua gccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu domain II gu a g u u c 200 ʜ gcggaaccggugaguacac cggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu domain IIIa domain IIIb ... Gaps introduced during alignment are indicated by a dot. A 63  TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA...

Ngày tải lên: 18/06/2014, 18:20

12 354 0
Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc

Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc

... dis- ease in chronic HBsAg carriers. We investigated the hepatic and extrahepatic patterns of HBV infection in a patient who was also infected with HIV and who was participating in a prospective ... Morsica* - morsica.giulia@hsr.it * Corresponding author Abstract Introduction: There seem to be no published data concerning the clinical impact of populations of hepatitis B virus (HBV) in the ... not for citation purposes) Journal of Medical Case Reports Open Access Case report Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report Sabrina...

Ngày tải lên: 11/08/2014, 17:21

7 348 0
Báo cáo y học: "Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients with chronic hepatitis C infection-associated polyarticular involvement" potx

Báo cáo y học: "Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients with chronic hepatitis C infection-associated polyarticular involvement" potx

... patients with chronic hepatitis C infection- associated polyarticular involvement Michele Bombardieri*, Cristiano Alessandri*, Giancarlo Labbadia, Cristina Iannuccelli, Francesco Carlucci, Valeria Riccieri, ... chronic HCV infection and associated articular involvement and 31 patients with chronic HCV infection without any joint involvement. In addition, we retrospectively analysed sera collected at ... presence of extrahepatic manifestations is a relatively common feature in patients with chronic hepatitis C virus (HCV) infection [1,2]. Among the different clinical disor- ders associated with HCV infection, ...

Ngày tải lên: 09/08/2014, 01:23

5 313 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

... long-term interferon therapy could achieve sustained eradication of HCV infection in renal trans- plant recipients with dual HBV and HCV infections. Consent Written informed consent was obtained from ... interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report Ming-Ling Chang 1 , Ping-Chin Lai 2 and Chau-Ting Yeh 3* Abstract Introduction: ... mortality in renal transplant recipients [2]. Besides accelerated deterioration of liver function in chronic HCV infection, HCV-related glomerulopathy [3] and HCV-associated fibrosing cholestatic hepatitis...

Ngày tải lên: 10/08/2014, 23:21

4 283 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

... physician should also offer counseling on treatment, reducing alcohol usage and immunization with hepatitis A, hepatitis B, pneumococcal and influenza vaccines. HCV negative persons with ongoing ... be elucidated. Conflict of interest The authors have declared that no conflict of interest exists. References 1. WHO. Global surveillance and control of hepatitis C. Report of a WHO Consultation ... Bacchus R, Ring C, Garson J. Hepatitis C virus in Egyptian blood donors in Riyadh. Lancet 1991; 33: 359-60. 18. Darwish NM, et al. Hepatitis C virus infection in blood donors in Egypt. J Egypt...

Ngày tải lên: 02/11/2012, 09:56

6 486 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

... Factors for Developing Chronic HCV Infection Risk Factors Age at time of infection > 25 years Male gender No jaundice or symptoms during acute infection African American race HIV infection ... develops. The rate of chronic HCV infection is affected by many factors, including the age at time of infection, gender, ethnicity, and the development of jaundice during the acute infection (see ... 180,000 cases per year in the mid-1980s (peak incidence), but declined to approximately 30,000 new cases per year in 1995.[13] The incidence of acute hepatitis C infection in the U.S. declined...

Ngày tải lên: 02/11/2012, 09:56

6 531 0
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

... Characteristic Endemicity of infection Low (%) Intermediate (%) High (%) Chronic infection prevalence 0.5-2 2-7 ≥8 Past infection prevalence 5-7 10-60 70-95 Perinatal infection Rare Uncommon ... the infant and adolescent vaccinatin programmes in Italy. Vaccine 2000;18:S31-S34. 77. Chang MH, Chen CJ,cLai MS. Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular ... the efficacy of hepatitis B vaccination. The incidence of HCC dropped from 3.27/10,000 to 0.17/10,000, a 94.8% decrease, in the group of 0-19 year-olds. The average incidence of HCC in general...

Ngày tải lên: 02/11/2012, 11:12

8 643 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... Paris, France). The primers used were VB1: 5Â-AAACATATGA GCATGAGCTACCACCTGGACC-3Â and VB3: 5Â-CTCG AGCTTCACAAGAAACTTCTGC-3Â. The PCR fragment was cleaved by the restriction enzymes Nde1 and Xho1 and inserted ... of a chimeric cDNA clone of hepatitis C virus genotype 1b are infec- tious in vivo. Virology 244, 161–172. 22 Mottola G, Cardinali G, Ceccacci A, Trozzi C, Bartholomew L, Torrisi MR, Pedrazzini ... amount of radioactivity incorporated into the nucleic acids was measured after TCA precipitation and plotted against the incubation time in minutes. T. Astier-Gin et al. Binding and replication of...

Ngày tải lên: 20/02/2014, 01:20

15 598 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf

Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf

... defences antiviral screening few cell lines support infection technical difficulties of primary cell culture HCV-LP Infection, morphogenesis cell attachment vaccination morphogenesis no secretion of ... during the culture of infected hepatocytes. To succeed in obtaining HCV infection in primary human hepatocytes, an existing model of hep- atitis B virus infection was used to determine optimal infection ... liver diseases includ- ing acute and chronic hepatitis, cirrhosis and hepatocellular carcinoma. Its high prevalence, the absence of a prophylactic vaccine and the poor effi- ciency of current therapies...

Ngày tải lên: 16/03/2014, 05:20

14 532 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

... using forward (5'-gcgcgcggatccgccagccccct- gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac- cgctcggaagtcttcc-3') oligonucleotides, and cloned in the BamHI site of ... was conceived by cloning in psiSTRIKE the pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). The Rluc:miR-328 ... or 3 copies of the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT (5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3') binding sites into the PmeI site of psiCHECK (Promega). The...

Ngày tải lên: 11/08/2014, 07:21

13 362 0
báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot

báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot

... care. The predictive value of SNPs is best calculated from rou- tine clinical practice, rather than the clinical trial sce- nario, since these are the conditions in which most patients are treated ... haplotypes are indicated in blue. Screenshot taken from UCSC draft human genome [28]. Table 1 Demographic characteristics of chronic hepatitis C patients after therapy Demographic factors a Gender Mean ... vitamin D 3 , and HLA -C genotype. From genotyping, SNP rs48 03221 and HLA -C C 2C2 provides the best predictive value. Clinical utility Therapy for HCV infection is currently undergoing a radical...

Ngày tải lên: 11/08/2014, 12:21

13 401 0
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx

Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx

... resulted in replacement of hydrophilic and basic amino acids with a neutral amino acid in rapid respon- ders and replacement of a neut ral amino acid with hydrophilic and basic amino acid in b reakthrough responders. ... are carriers for HCV [2]. In 60-80% cases HCV may lead to hepatocellular carci- noma (HCC) [3]. It comprises of 9600 nucleotides that predetermines a polypeptide containing 3010-3033 amino acids ... N: Predictors of the efficacy of interferon therapy in chronic hepatitis C virus infection. Tokyo-Chiba Hepatitis Research Group 1997, 113:558-66. 9. Kaufman RJ: The Double-stranded RNA-activated...

Ngày tải lên: 11/08/2014, 21:21

5 254 0
w