prevention of hepatitis c in egypt
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot
Ngày tải lên :
11/08/2014, 18:20
... for contracting hepatitis C. Stratification was
achieved in blocks of six within each variable, such that in
each block of six half of the clients would receive SEC and
half of the clients EPC. ... take place
through changes in outcome expectancies (expected con-
sequences of a course of action, e.g. sharing injecting
equipment) and self efficacy (confidence in one's ability
to achieve ... of
their effectiveness and cost-effectiveness in pragmatic clin-
ical trials.
Conclusion
We were not able to prove the efficacy of EPC in compar-
ison with SEC in the prevention of hepatitis C in IDUs.
Notwithstanding...
- 12
- 454
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
Ngày tải lên :
20/02/2014, 01:20
... Paris,
France). The primers used were VB1: 5Â-AAACATATGA
GCATGAGCTACCACCTGGACC-3Â and VB3: 5Â-CTCG
AGCTTCACAAGAAACTTCTGC-3Â. The PCR fragment
was cleaved by the restriction enzymes Nde1 and Xho1 and
inserted ... of a chimeric
cDNA clone of hepatitis C virus genotype 1b are infec-
tious in vivo. Virology 244, 161–172.
22 Mottola G, Cardinali G, Ceccacci A, Trozzi C,
Bartholomew L, Torrisi MR, Pedrazzini ... amount
of radioactivity incorporated into the nucleic acids was measured
after TCA precipitation and plotted against the incubation time in
minutes.
T. Astier-Gin et al. Binding and replication of...
- 15
- 597
- 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
Ngày tải lên :
16/03/2014, 05:20
... liver diseases includ-
ing acute and chronic hepatitis, cirrhosis and hepatocellular carcinoma. Its
high prevalence, the absence of a prophylactic vaccine and the poor effi-
ciency of current therapies ... and CD81 has been shown to be critical for
HCVcc infectivity. In fact, antibodies directed against
CD81 and CD81 downregulation with RNA interfer-
ence inhibited HCVcc entry into Huh7 cell lines
[10,20,83,91]. ... defences
antiviral screening
few cell lines support infection
technical difficulties of primary cell culture
HCV-LP Infection, morphogenesis cell attachment
vaccination
morphogenesis
no secretion of...
- 14
- 532
- 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
Ngày tải lên :
18/06/2014, 18:20
...
TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA
GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG
GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG
CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... 150
ʜʜ
cgucua
gccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu
domain II
gu a g u u c
200
ʜ
gcggaaccggugaguacac
cggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu
domain IIIa domain IIIb ... Gaps introduced during alignment are
indicated by a dot.
A
63
TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA
TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA...
- 12
- 354
- 0
Báo cáo y học: "Clinical Profiles of Chronic Hepatitis C in a Major County Medical Center Outpatient Setting in United States" pptx
Ngày tải lên :
08/08/2014, 18:20
... and specificity of the clinical discriminant score in diagnosing cirrhosis were
81.3% and 100%, respectively. Thus, the clinical discriminant score may underestimate the incidence of
cirrhosis, ... with chronic HCV infection, a series of epidemiological, clinical and
biochemical variables were collected at entry through a retrospective chart review. The clinical
variables collected included ... were consecutively collected from the Hepatitis Clinic at Los
Angeles County-USC Medical Center between January 1990 and December 1998. The inclusion criteria
included: chronic HCV infection...
- 9
- 388
- 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx
Ngày tải lên :
10/08/2014, 23:21
... interferon therapy in a renal
transplant recipient with dual infection with
hepatitis B and C viruses: a case report
Ming-Ling Chang
1
, Ping-Chin Lai
2
and Chau-Ting Yeh
3*
Abstract
Introduction: ... mortality in renal transplant recipients [2]. Besides
accelerated deterioration of liver function in chronic
HCV infection, HCV-related glomerulopathy [3] and
HCV-associated fibrosing cholestatic hepatitis ... long-term interferon therapy could achieve
sustained eradication of HCV infection in renal trans-
plant recipients with dual HBV and HCV infections.
Consent
Written informed consent was obtained from...
- 4
- 282
- 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
Ngày tải lên :
11/08/2014, 07:21
... using forward (5'-gcgcgcggatccgccagccccct-
gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac-
cgctcggaagtcttcc-3') oligonucleotides, and cloned in the
BamHI site of ... was conceived by
cloning in psiSTRIKE the pre-mmu-miR-328 sequence
(5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc
ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). The
Rluc:miR-328 ... or 3 copies of
the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT
(5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3')
binding sites into the PmeI site of psiCHECK (Promega).
The...
- 13
- 362
- 0
báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot
Ngày tải lên :
11/08/2014, 12:21
... care.
The predictive value of SNPs is best calculated from rou-
tine clinical practice, rather than the clinical trial sce-
nario, since these are the conditions in which most
patients are treated ... haplotypes are indicated in blue. Screenshot taken from UCSC draft human genome [28].
Table 1 Demographic characteristics of chronic hepatitis C patients after therapy
Demographic factors
a
Gender
Mean ... locations of these duplications are reflected in areas of poor mapability, as indicated by low scores on the
CRG Align 75 subtrack. The score for this subtrack is the reciprocal of the number of...
- 13
- 401
- 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
Ngày tải lên :
02/11/2012, 09:56
... physician should also offer
counseling on treatment, reducing alcohol usage and
immunization with hepatitis A, hepatitis B,
pneumococcal and influenza vaccines. HCV negative
persons with ongoing ... be elucidated.
Conflict of interest
The authors have declared that no conflict of interest
exists.
References
1. WHO. Global surveillance and control of hepatitis C. Report of a
WHO Consultation ... risk of acquiring the virus and should
involve providing education, risk reduction counseling,
HCV screening and substance abuse treatment. In the
US, the Centers for Disease Control (CDC) suggest...
- 6
- 486
- 0