prevention of hepatitis c in egypt
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot
... for contracting hepatitis C. Stratification was achieved in blocks of six within each variable, such that in each block of six half of the clients would receive SEC and half of the clients EPC. ... take place through changes in outcome expectancies (expected con- sequences of a course of action, e.g. sharing injecting equipment) and self efficacy (confidence in one's ability to achieve ... of their effectiveness and cost-effectiveness in pragmatic clin- ical trials. Conclusion We were not able to prove the efficacy of EPC in compar- ison with SEC in the prevention of hepatitis C in IDUs. Notwithstanding...
Ngày tải lên: 11/08/2014, 18:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... Paris, France). The primers used were VB1: 5Â-AAACATATGA GCATGAGCTACCACCTGGACC-3Â and VB3: 5Â-CTCG AGCTTCACAAGAAACTTCTGC-3Â. The PCR fragment was cleaved by the restriction enzymes Nde1 and Xho1 and inserted ... of a chimeric cDNA clone of hepatitis C virus genotype 1b are infec- tious in vivo. Virology 244, 161–172. 22 Mottola G, Cardinali G, Ceccacci A, Trozzi C, Bartholomew L, Torrisi MR, Pedrazzini ... amount of radioactivity incorporated into the nucleic acids was measured after TCA precipitation and plotted against the incubation time in minutes. T. Astier-Gin et al. Binding and replication of...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
... liver diseases includ- ing acute and chronic hepatitis, cirrhosis and hepatocellular carcinoma. Its high prevalence, the absence of a prophylactic vaccine and the poor effi- ciency of current therapies ... and CD81 has been shown to be critical for HCVcc infectivity. In fact, antibodies directed against CD81 and CD81 downregulation with RNA interfer- ence inhibited HCVcc entry into Huh7 cell lines [10,20,83,91]. ... defences antiviral screening few cell lines support infection technical difficulties of primary cell culture HCV-LP Infection, morphogenesis cell attachment vaccination morphogenesis no secretion of...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... 150 ʜʜ cgucua gccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu domain II gu a g u u c 200 ʜ gcggaaccggugaguacac cggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu domain IIIa domain IIIb ... Gaps introduced during alignment are indicated by a dot. A 63 TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo y học: "Clinical Profiles of Chronic Hepatitis C in a Major County Medical Center Outpatient Setting in United States" pptx
... and specificity of the clinical discriminant score in diagnosing cirrhosis were 81.3% and 100%, respectively. Thus, the clinical discriminant score may underestimate the incidence of cirrhosis, ... with chronic HCV infection, a series of epidemiological, clinical and biochemical variables were collected at entry through a retrospective chart review. The clinical variables collected included ... were consecutively collected from the Hepatitis Clinic at Los Angeles County-USC Medical Center between January 1990 and December 1998. The inclusion criteria included: chronic HCV infection...
Ngày tải lên: 08/08/2014, 18:20
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx
... interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report Ming-Ling Chang 1 , Ping-Chin Lai 2 and Chau-Ting Yeh 3* Abstract Introduction: ... mortality in renal transplant recipients [2]. Besides accelerated deterioration of liver function in chronic HCV infection, HCV-related glomerulopathy [3] and HCV-associated fibrosing cholestatic hepatitis ... long-term interferon therapy could achieve sustained eradication of HCV infection in renal trans- plant recipients with dual HBV and HCV infections. Consent Written informed consent was obtained from...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
... using forward (5'-gcgcgcggatccgccagccccct- gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac- cgctcggaagtcttcc-3') oligonucleotides, and cloned in the BamHI site of ... was conceived by cloning in psiSTRIKE the pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). The Rluc:miR-328 ... or 3 copies of the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT (5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3') binding sites into the PmeI site of psiCHECK (Promega). The...
Ngày tải lên: 11/08/2014, 07:21
báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot
... care. The predictive value of SNPs is best calculated from rou- tine clinical practice, rather than the clinical trial sce- nario, since these are the conditions in which most patients are treated ... haplotypes are indicated in blue. Screenshot taken from UCSC draft human genome [28]. Table 1 Demographic characteristics of chronic hepatitis C patients after therapy Demographic factors a Gender Mean ... locations of these duplications are reflected in areas of poor mapability, as indicated by low scores on the CRG Align 75 subtrack. The score for this subtrack is the reciprocal of the number of...
Ngày tải lên: 11/08/2014, 12:21
Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Conserved peptides within the E2 region of Hepatitis C virus induce humoral and cellular responses in goats" pptx
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... physician should also offer counseling on treatment, reducing alcohol usage and immunization with hepatitis A, hepatitis B, pneumococcal and influenza vaccines. HCV negative persons with ongoing ... be elucidated. Conflict of interest The authors have declared that no conflict of interest exists. References 1. WHO. Global surveillance and control of hepatitis C. Report of a WHO Consultation ... risk of acquiring the virus and should involve providing education, risk reduction counseling, HCV screening and substance abuse treatment. In the US, the Centers for Disease Control (CDC) suggest...
Ngày tải lên: 02/11/2012, 09:56