hepatitis c virus and human immunodeficiency virus coinfection in spain

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ⁄ core+1 sequence ... myc myc myc N6 (CCG414 fi TAA, Pro25 fi stop in core ORF) Deletion of core nts 342–514 ATG core+1 85 with optimal context GCCCCTCTATGG fi CCGCCACCATGG ATG core+1 85 with optimal context GCCCCTCTATGG...

Ngày tải lên: 30/03/2014, 03:20

18 365 0
Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

... highest active HCV infection was 2.13% observed in age group 31-40 years People including in age group 21-30 years revealed 1.82% active HCV infection High prevalence of HCV infection in male ... Biotechnology and Genetic Engineering; ICT: Immno-chromatographic Test; KP: Khyber Pukhtoonkhwa; M-MLV: Molony-murine leukemia virus; PCR: Polymerase chain reaction; RNA: Ribonucleic acid; RT PCR: ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar...

Ngày tải lên: 12/08/2014, 02:20

5 268 0
Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

... amplification and detection were accomplished concurrently with TaqMan technology (Applied Biosystems, Foster City, Calif) using fluorescent probes to detect amplification after each replicating cycle ... past in which un-sterilized syringes were used might have enhanced the infection rate in this country [23] This type of practice is still common in the countryside especially in KPK province which ... medical practitioners like doctors, vaccination teams and other medical persons used non-disposable syringes for injections attended a number of patients in the past Mass vaccination in the recent...

Ngày tải lên: 12/08/2014, 04:20

7 368 0
Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

... act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta aaa tt cgt aga aca gaa gac cgg c aga act gca aat cgt tcc ... Reference HCV HCV HCV HCV HIV HIV HIV HHV-6 HHV-6 HCV 9.1 HCV 9.2 HCV 10.1 HCV 10.2 Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act ... the commonly observed cytopathic effects in triply-infected CEM cells Large cells are seen with increasing frequency in infected cultures The triply infected CEM cells were observed by light microscopy...

Ngày tải lên: 18/06/2014, 18:20

8 410 0
Báo cáo hóa học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" pptx

Báo cáo hóa học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" pptx

... act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta aaa tt cgt aga aca gaa gac cgg c aga act gca aat cgt tcc ... Reference HCV HCV HCV HCV HIV HIV HIV HHV-6 HHV-6 HCV 9.1 HCV 9.2 HCV 10.1 HCV 10.2 Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act ... the commonly observed cytopathic effects in triply-infected CEM cells Large cells are seen with increasing frequency in infected cultures The triply infected CEM cells were observed by light microscopy...

Ngày tải lên: 20/06/2014, 01:20

8 446 0
Báo cáo hóa học: " Analysis of in vitro replicated human hepatitis C virus (HCV) for the determination of genotypes and quasispecies" docx

Báo cáo hóa học: " Analysis of in vitro replicated human hepatitis C virus (HCV) for the determination of genotypes and quasispecies" docx

... infectious and replicating HCV The variety of HCV RNA in patients could result from changes induced in the plasma/sera, including the production of noninfectious viruses We have drawn these conclusions ... such as cirrhosis and hepatocellular carcinoma, but this may be due to proteins produced in situ in the liver or by cells circulating in the blood Recently developing information suggests HCV ... changes, while HCV grown in T-cells had inconsistent changes, therefore lacked sequence commonality T-cells contained a mixture of Tcell subtypes, including CD4+ and CD8+ cells Guglietta et al [31]...

Ngày tải lên: 20/06/2014, 02:20

15 340 0
Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

... the hepatitis C virus, in and of itself, can directly induce cytoplasmic lipid accumulation Further studies examining the genotype virus are warranted to further recognize the process involved in ... cryptogenic cirrhosis JAMA 2003;289(22):3000-4 Scheen AJ, Luyckx FH Nonalcoholic steatohepatitis and insulin resistance: interface between gastroenterologists and endocrinologists Acta Clin Belg ... hepatitis C virus infection: Prevalence and clinical correlation J Gastroenterol Hepatol 2001;16:190-5 21 Lonardo A, Adinolfi LE, Loria P, et al Steatopsis and hepatitis C virus: Mechanisms and...

Ngày tải lên: 02/11/2012, 09:51

4 438 0
Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

... HBV and HCV infections are confirmed causes of HCC What’s the combined effect of HBV and HCV coinfection on HCC? Accumulated epidemiological data suggested that coinfection with HBV and HCV could ... HCV/HBV-coinfected patients in eradicating HCV infection and might promote HBV seroclearance Int J Med Sci 2006, 60 Dual Infection of HBV and HCV and hepatocellular carcinoma (HCC) Conflict of interest ... following acute HCV superinfection in HBV infection In this study, acute HCV superinfection in patients with chronic HBV infection is clinically severe during acute phase Moreover, during a follow-up...

Ngày tải lên: 02/11/2012, 09:51

6 621 1
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

... result, the exact prevalence of which is unknown Int J Med Sci 2006, Chronic hepatitis C In patients with clinical or biological signs of chronic liver disease, chronic hepatitis C is certain when ... case, to distinguish acute hepatitis C from an acute exacerbation of chronic hepatitis C or an acute hepatitis of another cause in a patient with chronic hepatitis C Acute hepatitis C is very unlikely ... exact subtyping is needed In clinical practice, HCV genotype can be determined by various commercial kits, using direct sequence analysis of the 5’ noncoding region (Trugene® 5'NC HCV Genotyping...

Ngày tải lên: 02/11/2012, 09:56

6 612 0
w