a novel method for the synthesis of cao nanoparticle
a novel method for the synthesis of cao nanoparticle
... (2008). Journal of Applied Chemical Research, 7, 4, 39-49 (2013) Journal of Applied Chemical Research www.jacr.kiau.ac.ir A Novel Method for the Synthesis of CaO Nanoparticle for the Decomposition of ... AP- CuO, AP-Fe 2 O 3 , AP-Al 2 O 3 and AP -CaO [15- 20]. There are several methods for the synthesis of nanoscale CaO, including sol-gel[21], gas p...
Ngày tải lên: 06/05/2014, 08:55
a novel method for the synthesis of titania nanotubes using
... nanotubular surface and thus increases the rate of formation of the nanotubes. On the other hand, the formation of the nanotubes using conventional magnetic stirring is retarded by the formation of a ... designated in the main text as UAT and SAT, respectively. 2.3. Annealing of the materials The anodized titania nanotubular arrays were annealed in a nitrogen a...
Ngày tải lên: 05/05/2014, 15:26
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... immediately upstream of the start codon (ATG). Primers with the fol- lowing sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... respectively, as a direct electron acceptor. The animal and plant l-gul- onolactone oxidoreductases are also active towards the l-galactono-1,4-...
Ngày tải lên: 07/03/2014, 12:20
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures
... potential environmental application in the removal of contaminants from wastewater, the photocatalytic activities of the as-synthesized ZnO samples were investigated by the degradation of KGL. ... ºC) sample had a larger surface area and a greater interspace between the nanosheets than the other samples. A greater interspace between the nanosheets can effectively...
Ngày tải lên: 06/05/2014, 13:26
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... 257 P554 GGCACTCGAACAGTCATATTG Exon 4 FDXR P557 ATTAAGGAGCTTCGGGAGATG Exon 7 380 P558 CTCTTATACCCAATGCTGCTG Exon 10 CYP1 1A First pair P561 GCCTTTGAGTCCATCACTAAC Exon 4 628 P562 CCAGTGTCTTGGCAGGAATC Exon ... Hospital Oakland Research Institute, Oakland, CA, USA for performing G C/MS an alyses, and Pr ofessor Walter Miller, U niversity o f C alifornia, San Francisco for the gift of N-...
Ngày tải lên: 23/03/2014, 13:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... FEBS naya OA, Kolpakov FA et al. (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26, 362–367. 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara ... 1162–1168. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase-1 by hypoxia in vascular endothelia...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx
... 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢. Western blot Cells were rinsed in NaCl ⁄ P i , trypsinized and ... and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c:5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthase subunit b:5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢- TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCC...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... may therefore repre- sent a potential therapeutic strategy for preventing the tau hyperphosphorylation and NFT formation characteristic of AD. Modulation of metal availability for treating AD ... a major component of the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease. The 39–43 amino acid cleavage pro...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx
... 5¢-CGCG CCATGGTGAAAACAGCAATTGTAACT-3¢ (NcoI) and 5¢-GCGCCCCGGGAAAAGAAAAACC-3¢ (SmaI); andtosubclonethetld gene into the vector pIVEX2.3MCS, 5¢-GCGCCATATGAAAATCTTAGTA-3¢ (NdeI) and 5¢-GCGCCCCGGGAATCGAAAGCTC-3¢ (SmaI). Each PCR ... regardless of the addition of the proteins. The peak that appeared at 24.0 min was in agreement with that of authentic NADP + . The reason why the...
Ngày tải lên: 17/03/2014, 10:20
solvothermal reactions- an original route for the synthesis of novel materials
... materials synthesis. Solvothermal reactions are mainly characterized by different chemical parameters (nature of the reagents and of the solvent) and thermodynamical parameters (in particular ... be taken into account: the nature of the reagents and the nature of the solvent. The chemical composition of the precursors must be appropriated to that of the target-m...
Ngày tải lên: 20/03/2014, 13:08
- cumulative specificity a universal mechanism for the initiation of protein synthesis
- a modern method for guitar school of tarrega volume 1 pdf
- a shell system for the generation of clinical documents
- titrimetric method for the determination of active chlorine in hypochlorite solutions
- use a defined constant for the size of an array