use a defined constant for the size of an array

... and therefore on the movement of all the other particles In the present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths of the other particles ... DMS9970943 and from Eurandom HK thanks Eurandom for appointing him as Eurandom Professor in the fall of 2002 He also thanks the Mittag-Leffler Institute and Eurandom for providing him with excellent facilities ... independently of each other The only interaction occurs when a B-particle and an A- particle coincide; the latter instantaneously turns into a B-particle [KSb] gave some basic estimates for the growth of the...

Ngày tải lên: 16/02/2014, 06:20

... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence ... theoretically preventable cause of cancer Consumption of adequate amounts of fruits and vegetables, and physical activity, appear to be protective against certain cancers Body weight and physical inactivity...

Ngày tải lên: 14/02/2014, 13:20

... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... balanced between the society and the individual, or resides with the individual, the manager will need to offer an exchange and will call on the use of marketing Homogeneity and behavior management ... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/or law as classes of strategic...

Ngày tải lên: 18/02/2014, 02:20

... transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara S & Miura T (1999) Positive and negative regulation of the human ... incubated at 37 °C for 20 After centrifugation, the supernatant was used to measure the absorbance at 468 nm The amounts of bilirubin formed in the reaction system were calculated using a value of ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S...

Ngày tải lên: 19/02/2014, 06:20

... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... facilitate this process may therefore be a critical factor in the Ab mediated pathology of the AD brain Subsequent to an early report demonstrating that the Cu- and Zn-induced aggregation of Ab could...

Ngày tải lên: 07/03/2014, 10:20

... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... horizontal transfer of vitamin C-related genes In the process of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower...

Ngày tải lên: 07/03/2014, 12:20

... vulcanus (Fig 1A) reacted with the antibodies against red algal PsbV [lane 5; anti(R-PsbV)] and cyanobacterial PsbU [lane 7; anti-(CPsbU)], but not with the antibody against red algal PsbU [lane ... with antibodies raised against their extrinsic proteins Lane 1, anti-(H-PsbP); lane 2, anti-(H-PsbQ); lane 3, anti(G-PsbQ); lane 4, anti-(R-PsbQ¢); lane 5, anti-(R-PsbV); lane 6, anti(R-PsbU); lane ... et al in the thylakoid membranes of C paradoxa (Fig 2) The C paradoxa thylakoid membranes reacted with anti-(R-PsbV) (lane 5) and anti-(R-PsbU) (lane 6) but not with anti-(C-PsbU) (lane 7); the...

Ngày tải lên: 23/03/2014, 15:21

... dissipated  when  a new wave arrives and breaks. Thus, the time  variation  of TKE  is  relatively  small,  and  the combination  of wave‐induced  flow  and  undertow may transport TKE and suspended  ... suitable  for a practical  application.  On  the other hand, based on results of Nadaoka et al  [9], Ting and Kirby [15‐17], it can be estimated  that  in  the surf  zone,  the time  scale  ... wave  breaking  on  a natural  beach  To  verify  the accuracy  of the numerical  model  on  the simulation  of the wave  transformation  on  a natural  beach,  existing  experimental data on the wave dynamics in ...

Ngày tải lên: 28/03/2014, 15:20

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated...

Ngày tải lên: 05/05/2014, 15:26

... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... nanoparticles and sulfurous compound, all samples were by studying the images indicates that the attached to a shaker and were shaken for about synthesized size nanoparticles are less than 12 h Then,...

Ngày tải lên: 06/05/2014, 08:55

... and coordination All the authors read and approved the final manuscript References Regulation (EC) No 1394/2007 of the European Parliament and of the Council of 13 November 2007 on advanced therapy ... with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone-marrow mononucleated cells used in cardiac regeneration Materials and methods ... technologies, Vancouver, Canada) and 20% fetal calf serum After 24 h of incubation transmigrated cells were counted Page of (page number not for citation purposes) Journal of Translational Medicine...

Ngày tải lên: 18/06/2014, 15:20

... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and ... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association...

Ngày tải lên: 18/06/2014, 16:20

... collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical ... scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final manuscript The members of the CRI-CIC Assay Working group critically ... and S2 Acknowledgements The organizers of this study are indebted to all the participating labs for their constant support of the proficiency panel program The organizers also thank Beckmann Coulter...

Ngày tải lên: 18/06/2014, 22:20

... collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical ... scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final manuscript The members of the CRI-CIC Assay Working group critically ... and S2 Acknowledgements The organizers of this study are indebted to all the participating labs for their constant support of the proficiency panel program The organizers also thank Beckmann Coulter...

Ngày tải lên: 20/06/2014, 04:20

... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The ... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analyzed the data and prepared the manuscript VB participated in the preparation of the bone cores and exposure of the samples to the different treatments, performed the microscopic analysis and helped...

Ngày tải lên: 20/06/2014, 04:20

... Fig 2a, only the G band (tangential mode), D band (related to disordered graphite or amorphous) and a shoulder at 1604 cm-1 (the fundamental E2g mode of graphite) are presented In the lower wavenumber ... spectrophotometer at room temperature and in a backscattering geometry, with Ar laser at 514.5 nm Results and Discussion Figure shows the Raman spectra for materials grown at different growth temperature (a: ... mg catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a flow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for...

Ngày tải lên: 22/06/2014, 00:20

... by the solvents and organics in the structural evaluation of NiO nanostructures The EDX measurement indicates that nanoparticles are composed of Ni and O, and the analysis in the NiO nanoparticles/nanoflowers ... band and holes in valence band There is a sharp band in the PL spectra of NiO nanoparticles and nanoflowers at 380 and 490 nm, respectively The visible emission is related to the defects-related ... spherical nanoparticles were produced for sample heated at 100 °C for 12 h (Fig 1b) The diameters of the nanoparticles are in the range of 50–70 nm with an average diameter of 60 nm Using higher reaction...

Ngày tải lên: 22/06/2014, 01:20

... earlier, the variances of the complex Gaussian random variables at the output of the Rayleigh simulator may have arbitrary values, depending on the variances of the Gaussian random variables at ... and (21)) As a result, the resultant complex Gaussian random variables {z j }N=1 in Z have zero means and variances j (powers) {σg j }N=1 j It is known that the means and the variances of Rayleigh ... because, in our considered case, Dk j are the actual distances between the kth transmitter antenna and the jth transmitter antenna, for k, j = 1, , Further, we assume that the variance σ of the...

Ngày tải lên: 23/06/2014, 00:20

... Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R Murty, Graph Theory ... the size of graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou Teachers ... 60, and 31t − 738 ≤ i ≤ 31t + 799) Now we define these Bi ’s These subgraphs all have a common vertex x, otherwise their vertex sets are pairwise disjoint For 7t+1 ≤ i ≤ t − 742, let the subgraph...

Ngày tải lên: 07/08/2014, 06:22

... A note on balanced Gray codes”, submitted for publication [10] A. J van Zanten and I N Suparta, “Totally balanced and exponentially balanced Gray codes”, Discrete Analysis and Operation Research, ... property an exponentially balanced Gray code (cf [10]), as a generalization of (totally) balanced Gray codes Thus, for an exponentially balanced Gray code G(n) one has that the transition count of ... and A. J van Zanten, “Balanced Gray codes”, rept CS 03-03, Institute for Knowledge and Agent Technology, Universiteit Maastricht, Maastricht, The Netherlands 2003 [9] Suparta, I N and A. J van Zanten,...

Ngày tải lên: 07/08/2014, 08:22