a novel method for the synthesis of titania nanotubes using
... jet targeted at the surface. This effect increases mass flow through the nanotubular surface and thus increases the rate of formation of the nanotubes. On the other hand, the formation of the nanotubes ... irradiation of ultrasonic waves— which quickly leads to the synthesis of well-ordered titania nan- otubes. The anodization approach builds self-organized...
Ngày tải lên: 05/05/2014, 15:26
... immediately upstream of the start codon (ATG). Primers with the fol- lowing sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... respectively, as a direct electron acceptor. The animal and plant l-gul- onolactone oxidoreductases are also active towards the l-galactono-1,4-...
Ngày tải lên: 07/03/2014, 12:20
... materials synthesis. Solvothermal reactions are mainly characterized by different chemical parameters (nature of the reagents and of the solvent) and thermodynamical parameters (in particular ... be taken into account: the nature of the reagents and the nature of the solvent. The chemical composition of the precursors must be appropriated to that of the target-m...
Ngày tải lên: 20/03/2014, 13:08
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... 257 P554 GGCACTCGAACAGTCATATTG Exon 4 FDXR P557 ATTAAGGAGCTTCGGGAGATG Exon 7 380 P558 CTCTTATACCCAATGCTGCTG Exon 10 CYP1 1A First pair P561 GCCTTTGAGTCCATCACTAAC Exon 4 628 P562 CCAGTGTCTTGGCAGGAATC Exon ... Hospital Oakland Research Institute, Oakland, CA, USA for performing G C/MS an alyses, and Pr ofessor Walter Miller, U niversity o f C alifornia, San Francisco for the gift of N-...
Ngày tải lên: 23/03/2014, 13:20
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... stimulate other initiatives at national, regional or local level, and to cooperate with similar fora at national level. At the same time, the Platform can create input for integrating the responses ... establish a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005. The Platform brings together all rel...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... to infinity on the upper right. Annals of Mathematics A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius SHAPE THEOREM FOR SPREAD OF AN INFECTION 719 We ... basic inequalities remain valid for k = 1 by trivial modifications which we again leave to the reader. For the various estimates we have to take all t k large. This w...
Ngày tải lên: 16/02/2014, 06:20
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... development of a relatively small amount of cell-life. The souring of milk, the formation of butyric acid, the making of vinegar from cider, are all examples of fermentative changes. With many bacteria, ... transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere. Distribution of bacteria. As bacteria possess greater powers of...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... bear. Other Variables Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/or law as classes ... and the singular choice of edu cation, marketing, or force of law as a paradigm of choice. Each paradigm has a role to play in behavior management; behavior management...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... FEBS naya OA, Kolpakov FA et al. (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26, 362–367. 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara ... 1162–1168. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase-1 by hypoxia in vascular endothelia...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx
... 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢. Western blot Cells were rinsed in NaCl ⁄ P i , trypsinized and ... USA). Data were normalized to b-globin. The sequences of the primers used in this study were as fol- lows: ERRa:5¢-AAGACAGCAGCCCCAGTGAA-3¢ and 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGA...
Ngày tải lên: 06/03/2014, 09:22