a novel method for the synthesis of titania nanotubes using

... jet targeted at the surface.This effect increases mass ﬂow through the nanotubular surfaceand thus increases the rate of formation of the nanotubes. On the other hand, the formation of the nanotubes ... irradiation of ultrasonic waves—which quickly leads to the synthesis of well-ordered titania nan-otubes. The anodization approach builds self-organized titania nanotubular arrays of controllable ... ultrasonic-mediated, mag-netically stirred, anodized titanium samples are designated in the main text as UAT and SAT, respectively.2.3. Annealing of the materials The anodized titania nanotubular arrays...

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... immediatelyupstream of the start codon (ATG). Primers with the fol-lowing sequences were synthesized by Proligo (Paris,France): 5forGulox (forward), 5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... respectively, as a direct electron acceptor. The animal and plant l-gul-onolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate.Only scarce data are available on the ... Vandekerckhove J, Van Montagu M,Zabeau M & Boerjan W (2001) Partial puriﬁcation andidentiﬁcation of GDP-mannose 3¢,5¢-epimerase of Ara-bidopsis thaliana, a key enzyme of the plant vitamin...

solvothermal reactions- an original route for the synthesis of novel materials

... materials synthesis. Solvothermalreactions are mainly characterized by different chemicalparameters (nature of the reagents and of the solvent) andthermodynamical parameters (in particular ... be taken into account: the nature of the reagents and the nature of the solvent. The chemical composition of the precursors must beappropriated to that of the target-materials. In addition, the concentration ... can act as a template dueto its octahedral geometry and can be incorporated into the structure of the ﬁnal material. This type of solvothermalreactions has led to the synthesis of Sb(III) and...

11
1,527
0

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... 257P554 GGCACTCGAACAGTCATATTG Exon 4FDXR P557 ATTAAGGAGCTTCGGGAGATG Exon 7 380P558 CTCTTATACCCAATGCTGCTG Exon 10CYP1 1A First pairP561 GCCTTTGAGTCCATCACTAAC Exon 4 628P562 CCAGTGTCTTGGCAGGAATC Exon ... Hospital Oakland Research Institute,Oakland, CA, USA for performing G C/MS an alyses, and Pr ofessorWalter Miller, U niversity o f C alifornia, San Francisco for the gift of N-62 StAR protein and ... controlplacenta, whole human skin, normal epidermal and immor-talized keratinocytes, dermal ﬁbroblasts, squamous cellcarcinoma and ﬁve human melanomas. Thus, these dataclarify in detail the cutaneous...

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

... stimulate other initiatives at national, regional or local level, and to cooperate with similar fora at national level. At the same time, the Platform can create input for integrating the responses ... establish a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005. The Platform brings together all relevant players active ... integrated and comprehensive approach towards the promotion of healthy diets and physical activity V.8.1. A coherent and comprehensive approach aimed at making the healthy choices available, affordable...

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

... toinﬁnity on the upper right.Annals of Mathematics A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius SHAPE THEOREM FOR SPREAD OF AN INFECTION719We ... basic inequalities remain valid for k = 1 by trivial modiﬁcations which we again leave to the reader. For the various estimates we have to take all tklarge. This will automatically be the case ... distribution at the space-time point (x + y, t + s)asthefull-space process (started at (0, 0)) at the point (y, s). Again we shall use the same random walk paths π A for all the full-state processes and...

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

... development of a relatively small amount of cell-life. The souring of milk, the formation of butyric acid, the making of vinegar from cider, are all examples of fermentative changes. With many bacteria, ... transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere. Distribution of bacteria. As bacteria possess greater powers of resistance than most other forms ... disseminate certain infectious diseases as typhoid fever and cholera among human beings, and a number of animal maladies. While the inner tissues of healthy animals are free from bacteria, the natural...

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... bear.Other Variables Influencing the Selection of Education, Marketing, and LawThere are many other variables that can influence managersin their selection of education, marketing, and/or law asclasses ... and the singular choice of education, marketing, or force of law as a paradigm of choice.Each paradigm has a role to play in behavior management;behavior management must be considered from the pragmatic ... positive and of assistance. The use of law can force a behavior that isdesirable to the target but is not viable because of pressure toconform to a different standard. In this case, the law canprovide...

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... FEBSnaya OA, Kolpakov FA et al. (1998) Databases ontranscriptional regulation: TRANSFAC, TRRD andCOMPEL. Nucleic Acids Res 26, 362–367.47 Takahashi S, Takahashi Y, Ito K, Nagano T,Shibahara ... 1162–1168.13 Nakayama M, Takahashi K, Kitamuro T, YasumotoK, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba-hara S (2000) Repression of heme oxygenase-1 byhypoxia in vascular endothelial cells. ... number AAG09721) are located adjacently in a head-to-head orientation, and their transcription startsites are  1.5 kb apart. We therefore analyzed the promoter function of the 1.5 kb 5¢-ﬂanking...

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

... 5¢-TAACCCCACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGATTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCACC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢.Western blotCells were rinsed in NaCl ⁄ Pi, trypsinized and ... USA). Data were normalized to b-globin. The sequences of the primers used in this study were as fol-lows: ERRa:5¢-AAGACAGCAGCCCCAGTGAA-3¢ and5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGGTTGACCCTGTTCCT-3¢ ... and 5¢-GTGTTTCAGGGCTTCTCTGC-3¢; Cyt c:5¢-CCAGTGCCACACCGTTGAA-3¢and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthasesubunit b:5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢-TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCCACCCTACTAAACC-3¢...

Xem thêm

Từ khóa: cumulative specificity a universal mechanism for the initiation of protein synthesis a modern method for guitar school of tarrega volume 1 pdf graphicalstatistical method for the study of structure and reaction processes of coal a shell system for the generation of clinical documents 2 specifying a time delay for the application of archived redo log files a new system for the integration of medical imaging processing algorithms into a web environment the synthesis of the modified tetrapyrrole known asd1haem requires several dedicated proteins which are coded for by a set of genes that are often found adjacent to the structural gene and there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly disease a framework for the evaluation of text a unified statistical model for the identification of english basenp a new approach for the morphological segmentation of highresolution satellite imagery an exact method for the stability analysis of timedelayed linear is there a tendency for the rate of profit to fall an exact method for the stability analysis of linear consensus protocols with time delay an exact method for the stability analysis of time delayed linear time invariant lti systems chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM