... (n) conjugates. Table 5. Thermodynamic activation parameters derived from the k 2 and k 3 steps for the hydrolysis of Suc-Ala-Ala-Pro-Phe-pNA by a- CT and the various lactose -a- CT, and dextran -a- CT ... Statistical correlation analysis (ANOVA) between the theoret- ical (*) and experimental global conformational (A) dynamics and (B) energetics parameters determined for the Lac -a...
Ngày tải lên: 19/02/2014, 05:20
... ZNHIT-1 siRNA were 5¢- GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA CTGAGGCAGTCTCG-3¢. These oligonucleotides were annealed and subcloned ... binding partners, a human fetal liver cDNA library was screened in a yeast two- hybrid assay using Rev-erbb as bait. A screen of approximately 10 6 yeast transformants reveale...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Bacterial IscU is a well folded and functional single domain protein pdf
... Bacterial IscU is a well folded and functional single domain protein Salvatore Adinolfi 1 , Francesca Rizzo 1 , Laura Masino 1 , Margie Nair 1 , Stephen R. Martin 1 , Annalisa Pastore 1 and ... r 2 0 Þ ÂÃ where A( r) and A( r 0 ) are the optical absorbances at radius r and at the reference radius r 0 , respectively; M is the molecular mass; x the angular velocity; R the gas const...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf
... EMSA DNA cleavage assay Quaternary structure by gel flitration Theoretical analysis Experimental analysis Domain organization Analytical ultracentrifugation Circular dichroism Fig. 10. Flowchart ... primers: 5¢-GAG ATA TAC ATA TGG GCG GAG GGG CGT CCA GCA AG-3¢ and 5¢-AAG CTT GAG CTC GAG CTC CTC CCT CTT CTT CTT CC-3¢. The DNA fragment was cloned into pET22b (Novagene, Merck, Darmstadt, Ger...
Ngày tải lên: 29/03/2014, 08:20
Strings and Vectors
... Addison-Wesley Chapter 8 Strings and Vectors Slide 8- 20 Copyright © 2007 Pearson Education, Inc. Publishing as Pearson Addison-Wesley C -strings as Arguments and Parameters C-string variables are arrays C-string ... arguments and parameters are used just like arrays If a function changes the value of a C-string parameter, it is best to include a parameter for the de...
Ngày tải lên: 12/09/2012, 22:51
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"
... González 3 , Nora Elena Saldarriaga 4 , Marisol Bedoya 1 , Juan Manuel Toro 5 , Jorge Byron Velásquez 4 , Juan Carlos Valencia 4 , Clara Maria Arango 5 , Pablo Henrique Aleman 1 , Esdras Martin Vasquez 4 , ... JV, CA, PA, EV, JCH, AY, WP and CC participated in the study design, data acquisition and drafting of the manuscript. All authors read and approved the final manuscript. Key mes...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"
... bladder in- continence, and sexual dysfunction 1,20 . However, in- flammatory reaction against the dead parasite is as- sociated with perilesional edema, which can damage medullar parenchyma and ... patients whom are highly suspected as intramedullary cysticercosis and whose clinical courses are stable. The potential ad- vantages of medical therapy alone include avoidance of surgery...
Ngày tải lên: 25/10/2012, 10:56
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
... that MZ with discordant handedness showed opposite brain activity patterns in language and a mental rota- tion task. Sommer et al. 14 have suggested that late splitting of the egg may play ... Ramsey NF, Mandl RC, et al. Language lateraliza- tion in monozygotic twin pairs concordant and discordant for handedness. Brain. 2002; 125: 2710-8. 15. Vernooij MW, Ikram MA, Tanghe HL, et...
Ngày tải lên: 25/10/2012, 11:00
Strings and Pattern Matching Pattern Matching
... một chút : : ̊ ̊ Giá trò băm c a Giá trò băm c a “AAAAA” “AAAAA” là là 100 100 ̊ ̊ Giá trò băm c a Giá trò băm c a “AAAAH” “AAAAH” là là 37 37 Dương Anh Đức Dương Anh Đức – – Nhập môn Cấu trúc ... ̊ ̊ ab ab + c + c ky ky ù ù hie hie ä ä u ta u ta ä ä p hơ p hơ ï ï p p { { ab ab , c} , c} ̊ ̊ a* a* ky ky ù ù hie hie ä ä u ta u ta ä ä p hơ p hơ ï ï p p {ε, {ε, a, a, aa aa , , aa...
Ngày tải lên: 18/09/2013, 21:53
Viewing a WSDL File and Testing a Web Service
... returns a DataSet with a DataTable containing the one row from the Customers table with a CustomerID of ALFKI, as shown in Figure 17.5 . Notice that the equals (=) and single quote (') characters ... method to return a DataSet with a DataTable containing all the rows from the Customers table (see Figure 17.6 ). Notice that the space characters in the whereClause parameter...
Ngày tải lên: 24/10/2013, 12:15