... than average and their maximum values are around The values for all these parameters obtained for the PsbQ model were quite good and the programs did not mark any as poor or inappropriate Another ... pore size) and stored at °C without any further treatment until required for chromatography The chromatographic steps were ¨ carried out in an Aktapurifier-100 apparatus (Amersham Pharmacia Biotech ... complex Mainly a; up/down bundle; four helices a b; two-layer sandwich All a; multihelical two all -a domains All a; up/down bundle; three helices Mainly a; orthogonal bundle; repressor Mainly a; up/down...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... form a distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available ... (Tubingen, Germany), and all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a- and b- domains The individual a- and b-domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA and MDPNCSCSTGGSCTCT ... towards a highly dynamic structure [8] Recently, a high-resolution solution structure of the C-terminal a- domain has become available The data revealed a tertiary fold very similar to that of MT-1 and...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
... hydrophobic side chains; this feature has been aptly described by Rajan et al as a Teflon coating that can surround a helix [16] in the case of a mixture of water and hexafluoroacetone hydrate, a mixture ... a- cyano-4-hydroxycinnamic acid as matrix Sample preparation It has been shown that a trifluoroacetic acid pretreatment renders Ab easily soluble in aqueous solutions and in organic solvents; the trifluoroacetic acid ... HFIP has been chosen as a result of a vast exploratory search because it can dissolve Ab-(1–42) better than all other media and, at the same time, it has a helix-promoting ability very similar to...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Dystrobrevin requires a dystrophin-binding domain to function in Caenorhabditis elegans doc
... stopped by adding EGTA to mM and heating at 65 °C for 10 DNA was purified on a Wizard column (Promega) and the action of BAL31 was checked by loading an aliquot of each tube onto an agarose gel ... (and GST alone) after incubation with equal amounts of in vitro translated 35 S-labelled DYS-1 The signal intensity of the autoradiogram was quantitated with a radiographic analyser (Biorad) MW, ... plate containing SD media minus leucin, tryptophan and histidine was seeded with yeast carrying DNABD-Dys-1 and various AD-Dyb-1 plasmids or empty pACT2 (as a negative control), and incubated at...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc
... pseudonana (Tp, a Diatom) The Viridiplantae (green, of a lighter shade for chloroplast genes) are Arabidopsis thaliana (At), Chlamydomonas reinhardtii (Cr), Chlorella vulgaris (Cv), Nicotiana tabaccum ... Adam Z, Adamska I, Nakabayashi K, Ostersetzer O, Haussuhl K, Manuell A, Zheng B, Vallon O, Rodermel SR, Shinozaki K & Clarke AK (2001) Chloroplast and mitochondrial proteases in arabidopsis a ... public databases and the in-house’ Clp database using fasta3 Growth of Chlamydomonas and subcellular fractionation Chlamydomonas reinhardtii wild-type and cell-wall less mutant (cw15) strains were...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: "Speakers’ Intention Prediction Using Statistics of Multi-level Features in a Schedule Management Domain" ppt
... (Goddeau, 1996), and a plan-based model (Litman, 1987) However, a finite-state model has a weak point that dialogue flows should be predefined Although a plan-based model can manage complex dialogue ... knowledge Since a frame-based model is more 231 3.1 Evaluation Data sets and experimental settings We collected a Korean dialogue corpus simulated in a schedule management domain such as appointment ... extracted from a sequence of utterances in a current dialogue • Domain knowledge-level feature: In a goaloriented dialogue, dialogue participants accomplish a given task by using shared domain knowledge...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
... antimicrobial peptides from South American hylids [32,34–37] and Asian, European AMWKDVLKKIGTVALHAGKAALGAVADTISQa GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa ALWKNMLKGIGKLAGQAALGAVKTLVGAE ALWKDILKNVGKAAGKAVLNTVTDMVNQa ... ACGTGCTTAGCAACGG-3¢ for caerin 1.15, and for nested PCR: 5¢-ATAACTGGAACAACGTGTGG-3¢ for caerin 1.1, 5¢-CTAAGTGCTCAGCAATGACG-3¢ for caerin 1.11, 5¢-AGCATAACTGGAACGTGGG-3¢ for caerin 1.12, 5¢-CAGCAATAAGTGGAACAACG-3¢ ... isolated India between 150 and 65 Ma and colonized the Laurasian land mass after India collided with Asia Abbreviations; AF, Africa; IND, India; AUS, Australia; SA, South America; ANT, Antartica...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo khoa học: The domains carrying the opposing activities in adenylyltransferase are separated by a central regulatory domain ppt
... scanned in a Foto Analyst Archiver (Fotodyne, Hartland, WI, USA) The scanning data were analyzed with imagequant V 1.1 software (Molecular Dynamics, Sunnyvale, CA, USA) Production of polyclonal ... constructs indicated that the central domain acted as a regulatory domain (see later) Indirect evidence from equivalent assay results with the entire AT protein where the R domain mAbs have been added ... PII-UMP in deadenylylation Addition of PII to the adenylylation assay or PII-UMP to the deadenylylation assay causes a shift in the position of the N domain relative to the C domain, and AT adopts...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo y học: ": Differential splicing of the apoptosis-associated speck like protein containing a caspase recruitment domain (ASC) regulates inflammasomes" doc
... Gout-associated uric acid crystals activate the NALP3 inflammasome Nature 2006, 440:237-241 Omi T, Kumada M, Kamesaki T, Okuda H, Munkhtulga L, Yanagisawa Y, Utsumi N, Gotoh T, Hata A, Soma M, et al.: An ... Taniguchi S, Ayukawa K, Sarvotham H, Kishino T, Niikawa N, Hidaka E, Katsuyama T, Higuchi T, Sagara J: ASC, a novel 22-kDa protein, aggregates during apoptosis of human promyelocytic leukemia ... 430:213-218 Yamamoto M, Yaginuma K, Tsutsui H, Sagara J, Guan X, Seki E, Yasuda K, Yamamoto M, Akira S, Nakanishi K, et al.: ASC is essential for LPS-induced activation of procaspase independently...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo khoa học:" Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain" docx
... TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC NS4B-CTD sub-Cys Forward primer, as for NS4B-CTD Reverse primer, AGATCTAGAGAGCCGGAGGATGGCGTGGAGGAGTCCTCGTTGATCCACTG d-LDH MBD Forward primer, GTGGGTACCATGAAATACGGCAAAGACACCTTCC ... TAGTCTAGAGAGCCGGAGCATGGCGTGGAGCAGTC NS4B-CTD Forward primer, GTGGGTACCATGGCGATACTGCGTCGGCACGTGGGC Reverse primer, as NS4B FL NS4B-deltaCTD Forward primer, as NS4B FL Reverse primer, TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC ... as swollen, partially vesiculated membranes and clustered aggregated membranes [19] NS4B is a hydrophobic protein with a molecular weight of approximately 27 kDa and has a modular domain organization...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: "Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain" pps
... TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC NS4B-CTD sub-Cys Forward primer, as for NS4B-CTD Reverse primer, AGATCTAGAGAGCCGGAGGATGGCGTGGAGGAGTCCTCGTTGATCCACTG d-LDH MBD Forward primer, GTGGGTACCATGAAATACGGCAAAGACACCTTCC ... TAGTCTAGAGAGCCGGAGCATGGCGTGGAGCAGTC NS4B-CTD Forward primer, GTGGGTACCATGGCGATACTGCGTCGGCACGTGGGC Reverse primer, as NS4B FL NS4B-deltaCTD Forward primer, as NS4B FL Reverse primer, TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC ... as swollen, partially vesiculated membranes and clustered aggregated membranes [19] NS4B is a hydrophobic protein with a molecular weight of approximately 27 kDa and has a modular domain organization...
Ngày tải lên: 12/08/2014, 04:21
A novel sec7 domain containing protein BIG3 and its role in regulated secretory pathway
... Abbreviations aa amino acid ACTH adrenocorticotropic hormone AMPK AMP-activated Protein Kinase AOX coenzyme A oxidase AP-1 adaptor protein-1 ARF ADP ribosylation factor Arg arginine ARNO ARF nucleotide ... CCC AGC CGG AAG AAG-3’ and 5’-CGC GTC GAC CAC AAT GAT GTC ATA GAC-3’ and digested with BamHI-SalI and ligated to C-terminal of EcoRI-BamHI fragment in pUC19 The full length of BIG3 at EcoRI-SalI ... pair: 5’-GCC GAA TTC CCA GAT GCT AAA GAA G-3’ and 5’-TAT GTC GAC AGG CCT GAG AGA TCC A- 3’ The PCR product was digested by EcoRI-SalI and ligated into pET-41b(+) vector His-BIG1Sec7 was generated...
Ngày tải lên: 11/09/2015, 09:15
Functional studies of BPGAP1, a novel BCH domain containing RhoGAP protein
... three ARAP contain five PH domains, an ArfGAP domain and a RhoGAP domain (Miura et al., 2002) ARAP1 and ARAP3 have equal GAP activity toward Rho, Rac and Cdc42 in vitro ARAP2 has no GAP activity ... cytoskeletal organization (Krugmann et al., 2002; Miura et al., 2002) BCR contains multiple protein domains including a Dbl domain, a PH domain and a C-terminal RhoGAP domain BCR has GAP activity ... Sekimata et al., 1999) PSGAP, a protein that interacts with PYK2 and FAD and contains multiple domains including a pleckstrin homology (PH) domain, a RhoGAP-activating protein domain and a Src...
Ngày tải lên: 17/09/2015, 17:20
Module 3 creating a windows 2000 domain
... performance, place the database and log files on separate hard disks Installing the database and log files on separate hard disks ensures that reads and writes to the database and log files are ... information: ● Full DNS name of domain. nwtraders.msft (where domain is your assigned domain name) ● NetBIOS domain name of DOMAIN (where DOMAIN is your assigned domain name) ● Default locations ... name), and then click Next b On the NetBIOS Domain Name page, ensure that DOMAIN (where DOMAIN is your assigned domain name) appears, and then click Next c On the Database and Log Locations page, accept...
Ngày tải lên: 04/12/2015, 16:52
Tài liệu Module 7: Designing a Multiple-Domain Structure pptx
... sales.us.nwtraders.msft When additional domains, or child domains, are attached to the initial domain they form a hierarchical structure Any child domain can be the parent of additional child domains Domains ... share a common directory schema, configuration information, and global catalog They also have automatic transitive trust relationships that allow users in each domain to gain access to available ... Designing a Domain Strategy for a Large Organization In this exercise, you will evaluate the scenario and design criteria at a large organization to determine the domain strategy for the organization...
Ngày tải lên: 17/01/2014, 09:20
Tài liệu Module 3: Developing a Domain Upgrade Strategy doc
... Domain europe.contoso.com asia.contoso.com Upgrading Account Domains Upgrading Account Domains nwtraders.com Upgrading Resource Domains Upgrading Resource Domains ƒ ƒDomains where you have easiest ... upgrade Are any domains reaching the upper limits of the SAM database? Yes, the Toronto domain has a SAM size of approximately 30 megabytes (MB) Are any domains targets for restructure? Not at this ... design of an organization „# Plan a domain upgrade to Active Directory Lab A, Developing a Domain Upgrade Strategy, is a scenario-based planning lab The students will collect information concerning...
Ngày tải lên: 18/01/2014, 05:20
Tài liệu Module 6: Developing a Domain Restructure Strategy doc
... between domains? All domains are located on a corporate local area network (LAN) and are connected by gigabit Ethernet At peak times, net available bandwidth averages 60% What is the Active Directory ... hardware available? Yes Each domain is allocated five spare servers that contain the exact hardware configuration of the servers currently in use What is the connectivity and bandwidth availability ... DNS Domain Name: Venus.contoso.msft Role: Account and Resource Domain NetBIOS Domain Name: Mars DNS Domain Name: Mars.contoso.msft Role: Account and Resource Domain NetBIOS Domain Name: Saturn...
Ngày tải lên: 18/01/2014, 05:20
Tài liệu Designing a Domain and OU Structure for Group Policy docx
Ngày tải lên: 24/01/2014, 19:20